Ondinea Species Images
Ondinea purpurea is a small member of the water lily family Nymphaeaceae that
grows, among other places, in shallow creeks of the Kimberley region of ...
www.victoria-adventure.org/ waterlilies/ondinea_species_images.html

water lily: Definition from Answers.com
Class: see text. Order: Nymphaeales. Family: Nymphaeaceae Salisb. (1805). Genera
. Barclaya · Euryale · Nuphar · Nymphaea; Ondinea; Victoria ...
www.answers.com/topic/water-lily

Pacific Bulb Society | Ondinea
Jul 15, 2009 ... Ondinea is a monotypic genus of flowering aquatic plants in the family
Nymphaeaceae native to northwestern Australia. ...
www.pacificbulbsociety.org/pbswiki/index.php/Ondinea

Ondinia
Additional comments: Ondinea is represented by a single species, ... Ondinea is
difficult to propagate over the long term in aquaria or ponds. ...
keys.lucidcentral.org/keys/aquariumplants2/Aquarium_& _Pond_Plants_of_the_World/key/Aquarium_&_Pon...

Nymphaea ondinea - Wikispecies
Aug 31, 2009 ... Basionym. Ondinea purpurea Hartog Blumea 18. 413. 1970. ... For more multimedia,
look at Category:Nymphaea ondinea on Wikimedia Commons. ...
species.wikimedia.org/wiki/Nymphaea_ondinea

IngentaConnect The unusual Ondinea, actually just another ...
Based on recent findings of phylogenetic studies using character sets from all
three genomic compartments and from morphology, Ondinea purpurea is ...
www.ingentaconnect.com/content/bgbm/ will/2009/00000039/00000001/art00005

Vessels in Nymphaeaceae: Nuphar, Nymphaea, and Ondinea
15, Lateral wall oí Ondinea purpurea ssp. petaloidea tracheary element;
striations present. Holes in twp lower fit niembranes ...
www.jstor.org/stable/2475118

Ondinea purpurea definition of Ondinea purpurea in the Free Online ...
A family of dicotyledonous plants in the order Nymphaeales distinguished by the
presence of roots, perfect flowers, alternate leaves, and uniaperturate ...
encyclopedia2.thefreedictionary.com/Ondinea+purpurea

Nymphaea ondinea subsp. petaloidea - Wikispecies
Aug 31, 2009 ... Ondinea purpurea subsp. petaloidea Kenneally & E.L.Schneid., Nuytsia 4(3): ...
For more multimedia, look at Category:Nymphaea ondinea subsp. ...
species.wikimedia.org/wiki/ Nymphaea_ondinea_subsp._petaloidea

nexus - Home | Brian O'Meara
... 'Victoria'
CAACTTTCGATGGTAGGATAGTGGCCTACCATGGTAGTGACGGGTGACGGAGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACAT
'Ondinea' ...
www.brianomeara.info/treebasematrix.php?id=2327