0
What unzips DNA strand is a particular protein called Helicase. Helicase unwinds DNA's double helix at the replication fork.
Wiki User
∙ 13y ago
Add your answer:
Earn +20 pts
What enzyne produces a new DNA strand during DNA replication?
The DNA polymerase enzyme produces a new DNA strand during DNA replication
Is DNA replication the same as DNA repair?
no replication makes a whole new strand of identical DNA while repair just replaces or cuts out mutations in the DNA strand
How many strands are replicated in DNA replication?
Two - the leading strand and the lagging strand.
What does replication mean in biology?
The process of duplicating or producing an exact copy, as in DNA replication.
What enzymes produced a new DNA strand during DNA replication?
DNA Polymerase
What bonds are broken in order the unzip the DNA strands?
The hydrogen bonds are broken in order to unzip the DNA strand. This all occurs during the DNA replication process.
What enzyne produces a new DNA strand during DNA replication?
The DNA polymerase enzyme produces a new DNA strand during DNA replication
What is the DNA strand that is synthesized continuously during DNA replication?
leading strand
What happens at the DNA replication fork?
The DNA replication fork is where the replication origin forms the Y shape. The replication fork moves down the DNA strand to the strand's end, resulting in every replication fork having a twin.
Is DNA replication the same as DNA repair?
no replication makes a whole new strand of identical DNA while repair just replaces or cuts out mutations in the DNA strand
How many strands are replicated in DNA replication?
Two - the leading strand and the lagging strand.
What acts as the origianl template in DNA replication?
A strand of DNA
What does replication mean in biology?
The process of duplicating or producing an exact copy, as in DNA replication.
What is replication forks?
A replication fork is the mechanism by which a strand of DNA is synthesized. If you can imagine a strand of DNA unwound, then it would resemble a ladder. Unzip the DNA and it now looks like a fork, ie fork in road, not eating fork. There is a Leading strand, which is synthesised easily. USing DNA polymerase which 'reads' along the strand in the 3' to 5' direction on the strand, producing a replication strand in the 5' to 3' direction. The opposite strand is called the lagging strand, and this is slightly more complicated. DNA polymerase cannot read in the 5' to 3' direction on the template strand. Thus DNA primase is used to read the strand and replicate small RNA segments, called Okazaki fragments. The lagging strand has no been copied into many small strands of RNA, or Okazaki fragments. Next DNA polymerase comes along and replaces all the RNA nucleotides with DNA nucleotides. ANd finally DNA ligase 'stitches' all the small fragments into one long strand.
During DNA replication a DNA strand has the bases Write the matching rna strand DNA ctagctagtctagtcctgatac RNA?
gaucgaucacucaggacuaug
What does semi conservation mean in terms of DNA replication?
DNA Replication is semi-conservative because each DNA molecule is composed of 1 old strand and 1 new strand
At the end of replication each new DNA molecule is composed of?
After DNA replication, each new molecule has one strand of the original DNA molecule and the other strand is composed of new nucleic acids. This is due to the semi-conservative replication of DNA.
