What would you like to do?

The four types of chromosomal mutations?

already exists.

Would you like to merge this question into it?

already exists as an alternate of this question.

Would you like to make it the primary and merge this question into it?

exists and is an alternate of .

There are four basic types of point mutations that can occur:

Substitution: This kind of mutation switches with another base to create an irregular sequence.
ex:) NORMAL - ABCDEFG
SUBSTITUTION - BACDEFG

Insertion: This kind of mutation involves the insertion of an extra base to the sequence.
ex:) NORMAL - ABCDEFG
INSERTION - ABHCDEFG

Deletion: This kind of mutation deletes or loses one of the bases in the sequence.
ex:) NORMAL - ABCDEFG
DELETION - ACDEFG

Frameshifts: This kind of mutation is where a sequence has an insertion or deletion, altering it. Since the sequence is divided into three bases to each section, which are called codons, the insertion or deletion of one of the bases can alter the codons completely, creating a different sequence, known as a frameshift.
ex:) NORMAL - ABC DEF GHI
FRAMESHIFT - BCD EFG HI

Those are the four basic types of point mutations, however there are other known mutations.
translocation,substitution,insertion,deletion
Thanks for the feedback!

What are the four types of mutations?

 -Insertions   -Deletions   -Replacements   -Flips     •AAATTGCTACGTCGATCGATCGGCCT   •AAATTGCTACGTCGATGATCGGCCT   •AAATTGCTAGCGTCGATCGATCGGCCT

What are the four types of choromosomal mutations?

4 types of chromosomal mutations are: Frameshift mutation (aka. insertion or deletion) - A base has been added or removed, so the whole rest of the code is shifted. This is

What are four types of chromosomal mutation?

Four types of chromosomal mutations are Down Syndrome (which is a mutation in which there are three copies of chromosome 21), Kinefelter Syndrome (which is a mutation in which

What are the 5 types of chromosome mutations?

1. Duplication - Where a portion of a chromosome is duplicated, resulting in multiple copies of the region. 2. Deletions - When a deletion of a nucleotide (nitrogen bases of

What are two types of Chromosomal mutations?

Two are insertion mutations and deletion mutations.

What are three types of chromosomal mutations?

Insertion, Deletion and Frameshift mutation. These are the 3 basic types of mutation, however, there are other types of mutations: substitution, translocation, duplication, in
In Biology

What do the four types of chromosomal mutations do?

The four types of chromosomal mutation are deletion, duplication, inversion and trasnlocation. Deletion is the loss of all or part of a chromosome. Duplication is where a segm