What would you like to do?

The four types of chromosomal mutations?

already exists.

Would you like to merge this question into it?

already exists as an alternate of this question.

Would you like to make it the primary and merge this question into it?

exists and is an alternate of .

There are four basic types of point mutations that can occur:

Substitution: This kind of mutation switches with another base to create an irregular sequence.
ex:) NORMAL - ABCDEFG
SUBSTITUTION - BACDEFG

Insertion: This kind of mutation involves the insertion of an extra base to the sequence.
ex:) NORMAL - ABCDEFG
INSERTION - ABHCDEFG

Deletion: This kind of mutation deletes or loses one of the bases in the sequence.
ex:) NORMAL - ABCDEFG
DELETION - ACDEFG

Frameshifts: This kind of mutation is where a sequence has an insertion or deletion, altering it. Since the sequence is divided into three bases to each section, which are called codons, the insertion or deletion of one of the bases can alter the codons completely, creating a different sequence, known as a frameshift.
ex:) NORMAL - ABC DEF GHI
FRAMESHIFT - BCD EFG HI

Those are the four basic types of point mutations, however there are other known mutations.
translocation,substitution,insertion,deletion
+ 45 others found this useful
Thanks for the feedback!

What would you like to do?

In Biology

What is the definition of chromosome mutation?

A chromosome is an organized structure of DNA and protein that is found in cells.In biology, mutations are changes to the nucleotide sequence of the genetic material of an org (MORE)

What would you like to do?

In Biology

What do the four types of chromosomal mutations do?

The four types of chromosomal mutation are deletion, duplication, inversion and trasnlocation. Deletion is the loss of all or part of a chromosome. Duplication is where a segm (MORE)

What is a Genetic Mutation?

Genetic mutations are changes in the DNA code of organisms. When mutations occur in the DNA code, the structure and function of cells can change, and lead to negative conseque (MORE)

The Screening Guidelines For BRCA Mutations Have Changed

Most breast cancers occur by chance, but some tumors are the result of inherited mutations of the BRCA gene. Guidelines for screening women who may have a BRCA mutation have (MORE)

10 Crazy Genetic Mutations You Won't Believe

Nature is crazy, and these naturally strange animals prove it.Albinism is extremely rare in gorillas. In fact, this white gorilla is the only known albino gorilla in all of re (MORE)

There's More Than One Way To Inherit A Breast Cancer Mutation

Most women are familiar with BRCA mutations as being the primary cause of inherited breast cancer. But scientists are finding other genes that confer a significantly increase (MORE)

What would you like to do?

In Biology

What are the 5 types of chromosome mutations?

1. Duplication - Where a portion of a chromosome is duplicated, resulting in multiple copies of the region. 2. Deletions - When a deletion of a nucleotide (nitrogen bases of (MORE)

What would you like to do?

Four types of alterations of chromosome structure?

  The four types of alterations of chromosome structure are deletion, duplication, inversion, and reciprocal translocation. Deletion is the loss of one or more nucleotides (MORE)

What would you like to do?

What are the four types of mutations?

 -Insertions   -Deletions   -Replacements   -Flips     •AAATTGCTACGTCGATCGATCGGCCT   •AAATTGCTACGTCGATGATCGGCCT   •AAATTGCTAGCGTCGATCGATCGGCCT (MORE)