0
The complementary DNA strand would be TTCGTT.
But assuming that the given strand is of mRNA, the DNA template would be TTCGTT and the tRNA would be UUCGUU.
Wiki User
∙ 14y ago
Wiki User
∙ 12y agoA - T and G - C
So: TCCGAT (or UCCGAU in RNA)
Wiki User
∙ 12y agoC binds to G and T binds to A.
Therefore the complementary DNA strand for ATT-GCA-ATT-GGC-GAA is:
TAA-CGT-TAA-CCG-CTT
Wiki User
∙ 12y agoGATGCGATCCGCTAACTTGA
T turns to A, A turns to T, G turns to C, and C turns to G.
Wiki User
∙ 15y agoaag tca tgt
Wiki User
∙ 11y agoCAAGTC
Add your answer:
Earn +20 pts
What would be the strand of complementary DNA produce by the strand of DNA tcg aag?
Purine- Adenine, guanine,pyrimidine- thymine, cytosineAdenine pairs with thymineGuanine pairs with cytosineTherefore the complementary strand to TCG AAG is AGC TTC=========================================================A always pairs with T, and C always pairs with G so the complementary strand is as follows:TCG AAG (Original)AGC TTC (Complementary)GCA TAT
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
During transcription, the DNA template is used to create a complementary strand of mRNA (messenger RNA). An A on the DNA template is complementary to a U on the mRNA, T to A and C to G. Therefore the complementary mRNA of TAC-GCG-CAT-TGT-CGT-CTA-GGT-TTC-GAT-ATA-TTA-GCT-ACG is: UTG-CGC-GUA-ACA-GCA-GAU-CCA-AAG-CUA-UAU-AAU-CGA-UGC
What would the DNA sequence have been for the following mrna strand cuc-aag-ugc-uuc?
mRNA forms a complementary sequence to the DNA it is transcribed from. Therefore, the DNA strand would be the complement (opposite base pair) from what is present in the mRNA. Also, remember that RNA uses uracil (U) in place of thymine (T). For the mRNA strand CUC-AAG-UGC-UUC, the complementary DNA strand would be GAG-TTC-ACG-AAG.
What is the untranscribed DNA tac ttt ttc tgg ata aag gcg ctc cgg ata ccc ccg ttc auu?
aug aaa aag aac uau uuc cgc gag ggc uau ggg ggc aac aag uua
If this strand of DNA were used what would be the complementary DNA produced CGA CT?
AGTCG (I'm assuming your strand was written in the normal 5' to 3' order, and I wrote mine in that order as well, which means the last residue in my strand pairs with the first residue in your strand, and vice versa).
What is the complementary strand for the sequence c t t a g g c t t a c c a?
G-A-T-T-A-G-C-C-T-A-A-G-G-T-C-GDNA base-pairing rulesAdenine - ThymineCytosine - GuanineRNA base-pairing rulesAdenine - UracilCytosine - Guanine
When was Rosedale - TTC - created?
Rosedale - TTC - was created in 1954.
When was Ellesmere - TTC - created?
Ellesmere - TTC - was created in 1985.
When was Kennedy - TTC - created?
Kennedy - TTC - was created in 1980.
When was Warden - TTC - created?
Warden - TTC - was created in 1968.
When was Chester - TTC - created?
Chester - TTC - was created in 1966.
When was Woodbine - TTC - created?
Woodbine - TTC - was created in 1966.
