SLC25A23 Gene - GeneCards | SCMC3 Protein | SCMC3 Antibody
Complete information for SLC25A23 gene (protein-coding), solute carrier family
25 (mitochondrial carrier; phosphate carrier), member 23.
www.genecards.org/cgi-bin/carddisp.pl?gene=SLC25A23

AceView: gene:Slc25a23, a comprehensive annotation of human, mouse ...
AceView offers a comprehensive annotation of human, mouse and nematode genes
reconstructed by co-alignment and clustering of all publicly available mRNAs ...
www.ncbi.nlm.nih.gov/IEB/Research/ Acembly/av.cgi?db=mouse&q=Slc25a23

Slc25a23 MGI Mouse Gene Detail - MGI:1914222 - solute carrier ...
Mouse Slc25a23 Chr17:57183138-57199286 bp, - strand has data for genome
coordinates, mammalian orthology, sequences, polymorphisms, SNPs, molecular
reagents ...
www.informatics.jax.org/javawi2/servlet/ WIFetch?page=markerDetail&key=50952

Gene : Cellular expression and alternative splicing of SLC25A23, a ...
A novel human member of the MSC gene family named SLC25A23, with homologs in
mammalian and non-mammalian species has been recently identified together with
...
linkinghub.elsevier.com/retrieve/pii/S0378111904007061

SLC25A23 siRNA (h) sc-97088
Click here for details. suitable control antibody: contact Technical Service for
availability of control antibody; RT-PCR Primer also available: SLC25A23 ...
www.scbt.com/datasheet-97088-slc25a23-sirna-h.html

SLC25A23 antibodies: Signal Transduction > Metabolism > Vitamins ...
SLC25A23 antibodies. ... SLC25A23 antibodies. Code. Name. Applications (see key)
& Reactivity (see key). Image Abreview Publication ...
www.abcam.com/index.html?t=263444&pt=1&c=3611&ei=&mu=ra

SLC25A23 - SNP Result
1: rs52464849 [Mus musculus]AAGAATTATTTATTTACTTTATGTAT[A/C]
TGAGTCCACTGTAGCTATCTTCAGA 2: rs52260936 [Mus ...
www.ncbi.nlm.nih.gov/sites/entrez? db=snp&cmd=search&sid=1&term=SLC25A23

SLC25A23 (solute carrier family 25 (mitochondrial carrier ...
Slc25a23 solute carrier family 25 (mitochondrial carrier; phosphate carrier),
member 23. Gene Identification. MGI: 1914222 (Current, syntenic, Gene) ...
www.komp.org/geneinfo.php?geneid=79280

66972 - Gene Result
1: Slc25a23 Official Symbol Slc25a23 and Name: solute carrier family 25 (
mitochondrial carrier; phosphate carrier), member 23 [Mus musculus] Other
Aliases: ...
www.ncbi.nlm.nih.gov/sites/entrez?db=gene&term=66972

SLC25A23 [PharmGKB]
SLC25A23. solute carrier family 25 (mitochondrial carrier; phosphate carrier),
member 23. Overview; Downloads/LinkOuts ...
www.pharmgkb.org/do/serve?objId=PA134932456