Medical Glossary:
CGG or CGG sequence
Shorthand for the DNA sequence: cytosine-guanine-guanine. Cytosine and guanine are two of the four molecules, otherwise called nucleic acids, that make up DNA.
Join the WikiAnswers Q&A community. Post a question or answer questions about "CGG or CGG sequence" at WikiAnswers.
Copyrights:
 |
 | Medical Glossary. © 2006 through a partnership of Answers Corporation. All rights reserved. Read more |
Search for answers directly from your browser with the FREE Answers.com Toolbar!
Click here to download now. 
Get Answers your way! Check out all our free tools and products.
ADVERTISEMENT
Tackle These
- What are the possible sequence variations of a 5 digit sequence using the ...
- MRNA sequence. 3' GUCAGAUGGAUAACUCAUGACAGGUACCA 5'determine the template DNA ...
- How does the DNA nucleotide sequence determine the amino acid sequence in a ...
- What is the sequence of mRNA given the amino acid sequence Met Trp Ala Glu? [unanswered]
- How sequence tagged sites are related to expressed sequence tags? [unanswered]
- How do you obtain expressed sequence tags from DNA sequence? [unanswered]
Keep Reading
ADVERTISEMENT
Do you have the answers?
ADVERTISEMENT
