What is a VNTR?

VNTR refers to variable number of tandem repeats, which is a kind of molecular marker that contains sequences of DNA that have end-to-end repeats of different short DNA sequences. When the repeating unit is 2 to 4 base pairs long, it is called an STR (short tandem repeat), and when the repeating unit is 2 to 30 base pairs long, it is called a VNTR. An example of a VNTR is GGATGGATGGATGGATGGAT, which is four tandem repeats of the sequence GGAT. In addition, VNTRs are highly variable regions, and thus there may be many alleles (gene variations) at many loci (physical location of a gene on a chromosome). VNTRs were discovered by Alec Jeffreys (1950-) and colleagues as they were working on the basics of DNA fingerprinting.

Previous question:	What is a transposon?
Next question:	What is the biological basis for DNA fingerprinting?

---