0
What would Translation of the DNA sequence AAGCTGGGA would result in?
Wiki User
∙ 6y ago
This would result in a frameshift mutation. This would cause the protein, after translation, to be truncated and would most likely be non-functional. This is due to a change in the amino acid sequence and would stop the protein from forming the correct secondary and tertiary structures due to a change in the electrostatic/ hydrophobic/ h-bonding etc. parameters of the protein
Wiki User
∙ 14y ago
Add your answer:
Earn +20 pts
Which do you suppose would be more harmful A mutation that changed the nucleotide sequence of an mRNA molecule or a mutation that changed the nucleotide sequence of a DNA molecule?
A mutation in a DNA nucleotide sequence would be more harmful than a mutation in a mRNA nucleotide sequence because it could cause the synthesis of multiple nonfunctional proteins in comparison to a mutation in a mRNA nucleotide sequence that would be less harmful because it would result in a few nonfunctional proteins.
DNA strand with old sequence CAGCAT?
the new DNA sequence would be GTCGTA, but the RNA sequence would be GUCGUA
How would the amino acid sequence produced by the mutant strand compare to the amino acid sequence produced by series 1?
one amino acid in the sequence would change
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complimentary DNA sequence would be TAGGCGATTGCATTGGG. The complimentary mRNA sequence would be UAGGCGAUUGCAUUGGG.
What would be the first three amino acids in the protein formed from this gene uagcgagg?
Each amino acid is coded for by a 3-base sequence known as a codon. Therefore you would need 9 bases to code for 3 amino acids.The sequence UAG-CGA-GG would not add three amino acids to a protein.For the sequence UAG-CGA-GG:UAG is a STOP codon - translation would cease at this point and no further amino acids would be added.CGA codes for Arginine.GG does not code for an amino acid - it would need one more base to be a codon. GGU, GGA, GGG and GGC all code for Glycine.
What would the peptide sequence be like after translation?
Check your answer
What would the formation of a main sequence star result from?
The accretion of matter due to gravity.
If you translate a heptagon what would it turn out to be?
Translation would result in a congruent heptagon at a different location.
What would happen if during translation of a protein the mRNA codon UAA sequence was presented?
This is a stop codon. The polypeptide would be completed here and would detach from the ribosome.
What would a single change in the sequence of nitrogenous bases in a DNA molecule most likely result in?
A mutation
Which do you suppose would be more harmful A mutation that changed the nucleotide sequence of an mRNA molecule or a mutation that changed the nucleotide sequence of a DNA molecule?
A mutation in a DNA nucleotide sequence would be more harmful than a mutation in a mRNA nucleotide sequence because it could cause the synthesis of multiple nonfunctional proteins in comparison to a mutation in a mRNA nucleotide sequence that would be less harmful because it would result in a few nonfunctional proteins.
What is the protein strand created from the mrna strand cagaaguuccucucgc?
The sequence of amino acids (forming a protein) that result from the mRNA strand CAG-AAG-UUC-CUC-UCG-C would be: Glutamine-Threonine-Phenylalanine-Leucine-Serine Each codon must be three bases long - therefore the end of this mRNA sequence 'C' cannot code for an amino acid. There would also need to be a stop codon at the end to complete translation.
What sequence of mRNA would go with the DNA sequence of act?
If the DNA sequence is ACT, the complimentary mRNA sequence would be UGA
What would be the effect of a mutation that changed the c of the anticodon to a g?
The effect of the mutation is; there would be another amino acid that may form due to the change in sequence of the anticodon. change in the sequence of anticodon may result to different amino acid that may form.
What is a nth term in a sequence?
Well, it would depend what the sequence was...? If the sequence was 2,4,6,8,10,12,14,16,18,20, then the 9th term would be 18!
What is the Mechanism of negative phase sequence relay?
A negative sequence relay is looking at unbalanced current, such as what would result from a line to line or line to ground fault. I'm not sure what you're meaning by "mechanism". Please explain if the above doesn't answer your question.
What would be the complimentary sequence of bases produced by a DNA strand with bases CTGCCA?
The sequence would be GACGGT
