0
DNA is a polymer, which means that is it composed of a series of similar units. In DNA, these units are called nucleotides, and are each made of a 5-carbon sugar, a phosphate group (including 4 oxygens), and a nitrogenous base. each nucleotide has one of the following bases: adenine, cytosine, guanine, and thymine. Being that DNA is in the form of a double-helix, the nucleotides on one strand need to attach to those on the other. They attach with hydrogen, but the bases tend to pair up as the following: adenine - thymine, cytosine - guanine
Wiki User
∙ 13y ago
Wiki User
∙ 12y agoThe ladder sides are sugar-phosphate molecules; the ladder rungs are hydrogen-bonded bases.
Wiki User
∙ 12y agoThe ladder sides are sugar-phosphate molecules; the ladder rungs are hydrogen-bonded bases.
Wiki User
∙ 14y agoThe rungs of the "ladder" are made up of the base pairs of Guanine and Cytosine or Adenine and Thymine.
Wiki User
∙ 13y agoit's actally a spiral ladder or a double helix and there is no good reson
Anonymous
DNA ladder, as a molecular-weight size marker, is a set of standards that are used to identify the approximate size of a molecule run on a gel during electrophoresis. When run alongside an unknown PCR product in an agarose gel, the ladder allows you to estimate the size of the unknown fragment by comparing it to the closest band in the ladder lane. Choosing the right electrophoresis products for your nucleic acid analysis workflow is critical to the success of the experiment. DNA ladders with pre-determined fragment sizes and concentrations are commercially in Leading Biology who is a professional supplier of customized makers. These can be run in either agarose or polyacrylamide gels.
Add your answer:
Earn +20 pts
What does a DNA nucleotide look like?
TCCAAGAACCTACATGTTCGCGTGTTCAGCGTCCATTTCAGTATTTAGCATAAATTTGAAGAGCCGAATGGCAGTTTTGGGAGGGACACGTTGTTTTAAAAGAAGCCTTCACGAAATTGTGACCGGTCTGGACTGAAAGTACCACGGATATCTAGCAGAAAACTAAGATTCCGCCAACCTTCTCTGTTTGCCTATGACCAACAGCATCTCAGGGT
What is each building block of RNA and DNA called?
DNA is formed with the bases thymine, adenine, guanine, and cytosine. RNA is formed with the same bases, only uracil replaces thymine. DNA's bases are connected to a sugar and a phosphate, and the sugar and phosphate are connected to each other- these form the rungs of the ladder. The guanine and adenine bases are each 2 'rings' long. The cytosine and thymine are 1 'ring' long. The bases connect to each other the form the step of the ladder. When you visualize it, the DNA forms a ladder, and when DNA is in it's actual 3D shape, it creates a double helix shape, or something that looks like a twisted ladder. RNA is made up of 3 kinds of RNA: rRNA, mRNA, and tRNA. RNA is also pretty similar to DNA. The main differences are that it is single instead of double stranded and it uses a dioxyribose instead of a sugar.
What is a DNA size standard and why is it used in gel electrophoresis?
You may be referring to the DNA ladder used in gel electrophoresis. The ladder is a collection of DNA fragments of known size (e.g. 100, 500, 1000, 2000, 5000, 10000 base pairs) so that if it is loaded beside the samples, it can offer a 'ruler' that can be used to determine the size of the fragments in the samples.
What is the texture and consistency of DNA?
The DNA is in the shape of a double helix, two strands twisted together like a ladder. The sides of the ladder is made up of the sugar phosphate portions of the adjacent nucleotides bonded together. The phosphate of one nucleotide is covalently bonded to the sugar of the next nucleotide. The nitrogenous bases on either sides of the DNA stands join together to form the rung of the ladder. Each base pair is formed from complimentary nucleotides, purines with pyramidines bound together by hydrogen bonds. The base pairs in DNA are adenine with thymine and cytosine with guanine.
What are the building blocks of DNA and RNA?
NucleotidesNucleotides are the monomers, building blocks, of nucleic acids (DNA and RNA). Each nucleotide includes three components: a phosphate, a sugar, and a nitrogenous base. The phosphate is bonded to the sugar through phosphodiester bonds and makes up the backbone of the molecule. The nitrogenous bases form the "rungs" of the ladder and are connected through hydrogen bonds. The phosphate is the same in DNA and RNA, but the sugar can be a ribose (for RNA) or a deoxyribose (for DNA). The latter is a ribose without "de-" one oxygen "-oxy-". There are four available nitrogenous bases in a DNA's nucleotides: adenine, thymine, guanine, and cytosine. RNA nucleotides feature the same bases with the exception of uracil, which replaces thymine. See related links and questions below.
The twisted ladder shape of the dna is called?
The twisted ladder shape of DNA is called a double helix.carbohydrate
How are the rungs of the DNA ladder broken as the DNA molecule unzips?
The rugs of DNA are Adenine, Guanine, Cytosine, and Thymine. When DNA replication occurs and the ladder has to be broken, an enzyme called "helicase" starts at the replication fork and unwinds the DNA ladder. Helicase breaks the rugs of DNA.
Shape of DNA?
The shape of a DNA molecule is called a Double Helix or a "Twisted Ladder"
The twisted ladder shape of DNA is called?
A double helix
What hold the side of DNA ladder together?
what holds the sides of the DNA ladder together
What do the two sides of the DNA molecule do in DNA Replication?
There are four bases in a DNA "ladder"... It is called a ladder because of the "two sides" and the bases... In DNA replication, they obviously replicate and the two sides are replicated as are the bases. (A,T,C,G)
The secret of DNA has to do with the sequence of what along the DNA ladder?
The sequence of the nitrogenous bases, which are the 'rungs' of the DNA 'ladder' are what give DNA its specificity.
What forms the side of a DNA ladder?
Phosphates and Sugars formthe sides of the DNA ladder~
What are the sides of the DNA ladder are made up of?
The DNA ladder is made of sugar and phosphates.
What is the DNA twisted structure called?
AnswerThe "twisted ladder" shape of DNA is called a double helix.
What is the purpose of the ladder marker DNA?
DNA passes through a gel at different speeds depending on its size. The purpose of the ladder marker of a DNA is to make the passing of DNA possible.
What is an allele ladder and what is its function in DNA profiling?
it is a ladder.
