0
If this strand of DNA were used what would be the complementary DNA produced CGA CT?
Wiki User
∙ 6y ago
AGTCG (I'm assuming your strand was written in the normal 5' to 3' order, and I wrote mine in that order as well, which means the last residue in my strand pairs with the first residue in your strand, and vice versa).
Wiki User
∙ 7y ago
Marquise Curtis
CAT GT -APEX
Wiki User
∙ 6y agoATG cc
Dan Loose
Anonymous
Wiki User
∙ 15y agoThe corresponding strand should be GCCATG C always bonds with G and G with C A always bonds with T and T with A
Wiki User
∙ 13y agoG pairs with C
A pairs with T (unless you have RNA)
so it would be GCCATG
Wiki User
∙ 11y agoThe corresponding strand would be gccatg.
Anonymous
Wiki User
∙ 12y agoAgc ttc
Anonymous
GCT GA
dally
Dennis Mason
Add your answer:
Earn +20 pts
What strand of DNA is used to make a complementary copy or to make a complementary mRNA molecule-?
The strand is called the parental strand. the gene being copied would depend on which protein is needed.
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
During transcription, the DNA template is used to create a complementary strand of mRNA (messenger RNA). An A on the DNA template is complementary to a U on the mRNA, T to A and C to G. Therefore the complementary mRNA of TAC-GCG-CAT-TGT-CGT-CTA-GGT-TTC-GAT-ATA-TTA-GCT-ACG is: UTG-CGC-GUA-ACA-GCA-GAU-CCA-AAG-CUA-UAU-AAU-CGA-UGC
Why are two new strands of DNA exactly like the old strand?
The new strands have new complementary bases on one side and the other is made of the original strand. A strand of DNA has two strands that are complementary to each other in a double helix. When it gets copied one side is used as a template for the new side being added on, the bases cytosine and guanine match up and the bases adenine and thymine match up to each other. For example: If the original DNA strand has this order: 3' G-A-T-A-A-C-C 5' then the new complementary strand has: 5' C-T-A-T-T-G-G 3'
What is formed when reverse transcriptase is used on a strand of mRNA?
A strand of DNA
What is formed when reverse transcriptase is used on of strand of mrna?
A strand of DNA
If this strand of DNA were used GTA CA what would be the complementary DNA produced?
CAT GT. -APEX Learning
What strand of DNA is used to make a complementary copy or to make a complementary mRNA molecule-?
The strand is called the parental strand. the gene being copied would depend on which protein is needed.
What strand of DNA is use to make a complementary copy or to make a complementary mRNA molecule?
The template strand is used to make a complementary copy. This is a type of DNA strand.
If this strand of DNA was used what would be the complementary DNA produced tac gg?
AGTCG (I'm assuming your strand was written in the normal 5' to 3' order, and I wrote mine in that order as well, which means the last residue in my strand pairs with the first residue in your strand, and vice versa).
What is used to make a new complementary strand of DNA?
The process of DNA replication.
What does DNA do after it is copied?
It joins up with its complementary strand. I may then be used to make RNA.
If this stand of DNA was used, what would be the complementary DNA produced CGA CT?
GCT GA :)
During DNA replication each strand of DNA is used as a template to produce a complementary strand of DNA. This process is shown below. Which base will attach to location 1?
Guanine
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
During transcription, the DNA template is used to create a complementary strand of mRNA (messenger RNA). An A on the DNA template is complementary to a U on the mRNA, T to A and C to G. Therefore the complementary mRNA of TAC-GCG-CAT-TGT-CGT-CTA-GGT-TTC-GAT-ATA-TTA-GCT-ACG is: UTG-CGC-GUA-ACA-GCA-GAU-CCA-AAG-CUA-UAU-AAU-CGA-UGC
Why are two new strands of DNA exactly like the old strand?
The new strands have new complementary bases on one side and the other is made of the original strand. A strand of DNA has two strands that are complementary to each other in a double helix. When it gets copied one side is used as a template for the new side being added on, the bases cytosine and guanine match up and the bases adenine and thymine match up to each other. For example: If the original DNA strand has this order: 3' G-A-T-A-A-C-C 5' then the new complementary strand has: 5' C-T-A-T-T-G-G 3'
What is important about the DNA template strand?
The template and non-template strands of DNA are complementary.This means that if a T (thymine)occurs on one strand, there must be an A (adenine) in that position on the other strand, and that C (cytosine) is always opposite G (guanine), following the rules of complementary base pairing.There are other names for the two strands, but Googling them shows there is a lot of confusion out there! The terms "template strand" and "non-template stand" seem to be the only ones that everyone uses consistently. The template strand is the strand along which messenger RNA is synthesized, and has, of course, a base sequence complementary to that of the RNA.The term "gene" is often applied to the non-template strand, the argument being that the non-template DNA strand and the mRNA have the same base sequence (except that where DNA has T, RNA has U, uracil).In transcription, RNAP uses template strand to make a copy of mRNA. Complementary to template strand is the coding strand, which sequence is identical to mRNA sequence except for the substitution of U for T. Although the coding strand is not used as a template for common transcription events, it is called coding because its sequence is used as a copy in mRNA sequence. For the case of "sense", terminologically template strand is called antisense, and coding strand is called the sense strand.Template/non-coding/antisenseNon-template/coding/senseMany people confuse complementary sequences with palindromic sequence which you can find in restriction system recognition sequences. Although the template strand yields a sense (functional) sequence in mRNA and thus a properly-folded protein, the complementary strand of it, non-template strand upon being transcribed yields a totally different and non-functional protein. However in terms of transcription of palindrome, both strands yield the same mRNA sequence, thus the same protein.Coding strand of a particular gene can be on one of either two strands of DNA, and thus this applies to the opposite strand of the said strand for the non-coding strand. The direction of transcription on a double-stranded DNA depends on whether the upper or lower strand is being transcribed. Therefore on a linearised genome, transcription occurs to the left for certain genes and to the right for the remaining genes.
What is the mrna sequence for a strand of dna reading ccgtact?
The template sequence would be 5' TTGATGGCT 3'. You can find any DNA template sequence by finding the complementary base pair sequence for the mrna sequence. To do this, remember that A matches with U or T (U is used in the RNA strands wheras T is used in the DNA strands) and G matches with C (and vice versa). Next just flip the 5' and 3' ends because the complementary strands are always antiparallel to each other.
