answersLogoWhite

0

Subjects>Science>Natural Sciences

5cm equals how many inches?

User Avatar

Anonymous

∙ 15y ago
Updated: 5/24/2024

Since there are 2.54 centimeters to the inch, you can see that the answer will be close to 2. In fact the number is a tiny bit larger than 1.9685.

User Avatar

Wiki User

∙ 15y ago
Copy

What else can I help you with?

Continue Learning about Natural Sciences

0.75 inches equals how many millimeters?

0.75 inches equals 19.05mm


150 cm equals how many inches?

it equals 59.055118 inches


36 inches equals how many foot?

36 inches = 3 feet


16.51 cm equals how many inches?

6.5 inches


Is 5cm equivalent to 2 inches?

Actually, 5 cm is almost two inches. (1.968 inches).

Related Questions

5cm equals how many dm?

5cm equals 0.5dm


How many inches is 5cm?

About 2 inches


How many inches the 5 centimeter?

5cm is 1.9685 inches.


5cm equals how many mm?

50mm


5cm equals to how many dm in decimals?

0.5dm


How many inches long is 5cm?

5 centimeters = 1.96850394 in


10cm x 5cm x 5cm equals?

250 cm3


What is the scale factor for 5cm equals 2 km?

2km/5cm = 200000cm/5cm = 40000/1


How long in inches is 5cm?

two [2] inches.


How may inches is 5cm?

1.9685


How big is 5cm?

1.9685 inches


What does 5 cm look like?

5cm ~ 2 inches. It approximately the length of the two lowest flanges of your thumb.

Trending Questions
What is the approximate temperature used for heel warming? When did the mesolithc era begin and end? When connecting a 240V line with two hot wires and a ground does it make a difference if the red or black hot wires are connected to L1 or L2 for a jet pump pressure switch? Is silica sand usable for photovoltaic cells - solar cells - in scarce supply? 1 hectare how many acres? Is a starfish an herbivore? Why it is important to study crystal structure? What was the biggest snow storm in Transylvainia? What does it mean if an individual in a pedigree is labeled with R? When two air masses meet they mix together? Name something that has bubbles in it? What is the plural possessive form of experiments? Fluid travel from high pressure to low pressure Is this statement is true for liquid gas and plasma? How sugar is synthesized with a light independent reaction? Is freezing your water in the bottle and drinking it bad for you? What is a group of two or more atoms that is held together by bonds.? Is a light bulb considered a fixture? What two jobs do all ecosystems share? What stars are in the constellation Lion Leo? What is the mRNA strand for ggctatatcctgcgctatacgcta?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.