0

Subjects>Science>Biology

Name the four nitrogen bases

Anonymous

∙ 14y ago

Updated: 6/12/2024

There are 4 nitrogenous bases found in DNA; Cytosine, Adenine, Guanine, and Thymine. Cytosine pairs with Guanine, and Thymine pairs with Adenine.

*In RNA, Uracil replaces Thymine, therefore Adenine pairs with Uracil, in RNA.*

Wiki User

∙ 14y ago

What else can I help you with?

Continue Learning about Biology

What is the nitrogen bases in rna?

Nitrogen bases of RNA are adenine, guanine, cytosine and uracil.

Adenine guanine cystocine and thymine are the four nitrogen bases in DNA true or false?

There are four nitrogen bases found in DNA: adenine, guanine, cytosine, and thymine.

4 nitrogen bases in RNA?

The four nitrogen bases in RNA are Uracil, Adenine, Cytosine and Guanine.

Four nitrogen bases in RNA?

The four nitrogenous bases in RNA are adenosine, guanine, uracil and cytosine.

What are the four type of nitrogen bases?

The four types of nitrogen bases in DNA are adenine (A), thymine (T), cytosine (C), and guanine (G).

Related Questions

What is the name of the four nitrogen bases in DNA?

Adenine, Thymine, Cytosine, and Guanine.

Name the four nitrogen bases that make up DNA?

Adenine, cytosine, guanine, thymine.

What is the nitrogen bases in rna?

Nitrogen bases of RNA are adenine, guanine, cytosine and uracil.

Have many nitrogen bases does the DNA of a bacteria have?

Bacterial DNA has four nitrogen bases; adenine, guanine, cytosine, and thymine.

Adenine guanine cystocine and thymine are the four nitrogen bases in DNA true or false?

There are four nitrogen bases found in DNA: adenine, guanine, cytosine, and thymine.

What are the abbreviations for the four nitrogen bases that form molecules?

ixdskj

4 nitrogen bases in RNA?

The four nitrogen bases in RNA are Uracil, Adenine, Cytosine and Guanine.

Four nitrogen bases in RNA?

The four nitrogenous bases in RNA are adenosine, guanine, uracil and cytosine.

What are the 4 DNA?

AdenineThymineCytosineGuanineThese are the four nitrogen bases found in DNA.

What are the four nitrogen bases for DNA?

Adenine, Thymine, Cytosine and Guanine.

What is four types of nitrogen bases?

Adenine, Guanine, Thymine, and Cytosine.

Adenine guanine cytosine and thymine are four kind of?

Nitrogen Bases

Trending Questions

How can Cleft lip and cleft palate be detected? What is the role of the gluteus medius and minimus tendons in hip stability and movement? What role do ddNTPs play in the process of DNA replication? What happens to the signal transmission when myelin is damaged? What transports water and minerals up from the roots to the rest of the plant? What percent is homozygous recessive? Muscle tissue is made up of cells that contract and release to produce movement Which process provides the energy that the cells need to contract? How do homologous structures among animals provide evidence for evolution? What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg? How would the membrane behave if the fatty acids tail consisted mostly of unsaturated fats? Do homologous structures have dissimilar constructions? How do cells from the excretory system transform into organs? What is the common name of yucca brevifolia? How do the events in cell cycle ensure that the genetic information in the daughter cells will be identical to that of the parent cell? Four functions of food to the body? What is the ecological development of a community called? What cells are primitive cells that contain no nucleus or organelles and also known as bacteria? Explain why large active organisms need special surface for exchange? When is a recessive allel expressed in offspring? What is a true statement about microevolution and macroevolution?

Resources

Top Categories

Product

Company

Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.