answersLogoWhite

0

Clinical features refer to the signs and symptoms associated with a particular medical condition. These may include observable physical signs, such as a skin rash, as well as subjective symptoms reported by the patient, such as pain or fatigue. Clinical features are important for diagnosing and managing diseases.

User Avatar

AnswerBot

1y ago

What else can I help you with?

Continue Learning about Biology

What are the clinical features of cementoblastoma?

Cementoblastoma presents as a slow-growing, benign odontogenic tumor typically affecting the mandible. Clinical features include pain, swelling, tooth mobility, and root resorption of the affected tooth. Radiographically, it shows a well-defined radiopaque mass attached to the root of a tooth.


What does clinical remission mean?

Clinical remission refers to the absence of signs and symptoms of a disease. In the context of a medical condition, achieving clinical remission indicates that the disease is no longer active or causing noticeable effects on the individual's health. Treatment may still continue to maintain the remission.


What does clinical control mean?

Clinical control refers to the ability of healthcare providers to manage a patient's medical condition effectively. It involves monitoring the disease or symptoms, adjusting treatment as needed, and aiming to achieve the best outcomes for the patient. Good clinical control typically results in reduced symptoms, improved health, and better quality of life.


What are the 12 parts of a clinical microscope?

(2)EyepiecesFrameViewing TubeNosepieceStage(4)ObjectivesStageSpecimen HolderCondenserIlluminatorFilterPower CordThe truth is there is no STANDARD clinical microscope. You can have way more than 12 parts on a clinical microscope.You can visit www.seoenterprises.com to see some of the more expensive clinical microscopes and see what they come with.If you look at the Nikon 50i or 55i, you'll see what I mean.


Who is in charge of a clinical lab?

A clinical lab is usually overseen by a clinical laboratory director, who is responsible for managing the laboratory operations, ensuring quality control, compliance with regulations, and overall performance of the lab. The director is typically a pathologist or a scientist with appropriate qualifications and experience in clinical laboratory science.

Related Questions

What do you mean by clinical features?

Clinical features refer to the signs and symptoms that healthcare providers observe and patients experience during a medical examination. These features help in diagnosing and determining the progression of a disease or condition.


What are clinical features?

Clinical features refer to the signs and symptoms that characterize a particular disease or condition. These features are observed and assessed by healthcare professionals during a clinical examination to aid in making a diagnosis or monitoring the progression of a disease. They can include things like pain, fever, swelling, rash, changes in laboratory values, and more.


After a mri of the spine cervical what does clinical correlation mean?

After mri,on lower spine what does clinical correlation mean


What causes NPD-C?

Mutations in two independent genes result in the clinical features of this disease.


What does clinical trial mean in science terms?

essentially clinical trials are testing on members of the public that volunteer themselves for such test


What does the medical abbreviation DCP mean?

diploma in clinical pathology


What does atypia mean?

Atypia is a clinical term for abnormality in a cell


What does the medical abbreviation CBE mean?

Clinical Breast Examination


What does in clinic mean?

clinical means a type of mental illness.


What has the author A Friesen written?

A. Friesen has written: 'Microbiological pharmacological and clinical features of Bactrim' -- subject(s): Sulfamethoxazole


What are the clinical features of cementoblastoma?

Cementoblastoma presents as a slow-growing, benign odontogenic tumor typically affecting the mandible. Clinical features include pain, swelling, tooth mobility, and root resorption of the affected tooth. Radiographically, it shows a well-defined radiopaque mass attached to the root of a tooth.


What does clinical implications mean?

Clinical implications are common in research studies. There are some brief notes that highlight the concepts, diagnostics and recommendations of the findings.

Trending Questions
What is a cumpuat? What causes hyperlipdemia? Small nucleus found in most ciliates? After a night of heavy drinking you notice that you are sweating more than usual while working out and your muscles ache These symptoms are most likely due to? How ear defenders effect pitch and amplitude of sound? What are the codons and anticodons for the sequence auguucguuaacgaccaaauuuaa? Why the formation of calluses on the hands provides evidence that cell division can be stimulated by cell damage? What is embryonal cell carcinoma? How does the nephron function? What are the 4 components that all prokaryotic cells have? What traits make archeabacteria likely relatives of Earths earliest organisms? Do all animal cells have the same organelles? What form of nitrogen can plants utilize for growth and development? Are protists ecologically important because they provide carbon dioxide for other organisms? Is the sternum posterior to the vertebral column? Classify that you are stranded on an island equipped with only a microscope. describe what you could do to determine whether an unknown object is from a living or nonliving thing? How grasses are pollinated? What are the key stages in the scale insect life cycle and how do they contribute to the overall population dynamics of these pests? What is ATP's role in photosynthesis and how does it contribute to the overall process of converting light energy into chemical energy in plants? What is Focal Adhesions and Hemidesmosomes?