0
Thalassemia is a genetic blood disorder where the body has difficulty producing enough hemoglobin, leading to anemia. It can range in severity from mild to severe and requires lifelong management with blood transfusions and other treatments. Factors such as genetics and family history play a role in the development of thalassemia.
What else can I help you with?
Continue Learning about Biology
Related Questions
Trending Questions
What is a runner?
What steps of glycolysis are irreversible?
What is the life span of an flowering plant for example a strawberry?
How can you effectively kill bacteria in your stomach?
What is the difference between a rough ER and a Smooth ER?
What is the movement of sugar in a plant called?
Does the term sterile means free of all life forms?
What happens when a cotton shirt and a wool sweater rub together why?
Are teeth stronger than bones?
In what part of a plant does photosynthesis occur?
What structures in the ear enable the process of hearing sound?
Can h plyori live in the gallbladder?
What is the process by which haploid gametes combine?
What did scientists discover with the help of microscopes?
What Hypofunctioning of the adrenal cortex leads to what condition?
What purpose does poison ivy serve?
What is the most important role of aerobic bacteria in the treatment of waste water?
What are the complementary bases for the following DNA strand aatggccttagcagttgcatga?
An escherichia coli bacterium daughter cell inherits the exact DNA from its parents cell during the process of what?
Why does a dandelion appear yellow in white light?
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.