answersLogoWhite

0

UHhHM, YES.

User Avatar

Wiki User

12y ago

What else can I help you with?

Continue Learning about Biology

Where in the girl's body does the period blood come out?

Your Vagina From the vaginal orifice.


What you feel when you enter a pen inside your vagina?

Inserting a pen into the vagina can cause discomfort, pain, or even injury, as the vagina is a sensitive area with delicate tissues. It is not a safe or recommended practice and can lead to infection or other complications. If you are experiencing discomfort or have concerns, it's important to seek medical advice.


If a girl and guy wearing underwear and guys sperm come out in his underwear and it touches girls underwear and then guy do fingering through her underwear will girl get pregnant?

Pregnancy can occur if sperm comes into contact with the vagina, regardless of whether it goes through clothing. While the chance of pregnancy in this scenario is low, it is not impossible. It is always best to use protection to prevent unwanted pregnancy and sexually transmitted infections.


Can a girl get pregnant if she had her shorts and panties on and the guy had his boxers and shorts on and ejaculated on the girl's shorts?

The answer to this is NO. A girl can only get pregnant IF ejaculate somehow gets into the vagina. If a girl has both shots AND panties on she pretty much should have nothing to worry about if the guy did ejaculate on her shorts.


Where in the girl's body does the period blood come from?

Period blood comes from a girl's uterus. When a girl has her period, the uterus sheds the lining it builds up to feed an egg. When the egg isn't fertilized, the lining, which is made up of blood and clots, falls off of the walls and comes out of her cervix, the bottom of her uterus that opens into the end of the vagina, and then the blood flows down out of the opening of her vagina.

Related Questions

What is camel toe on a girl?

When a woman wears tight pants, the pants will ride tight against her crotch. Because a woman has a vagina, the vaginal lips protrude against the pants. The crotch of the pants then form a u shape, similar to the shape of a camel's toe.


What is the difference between boy and girl training pants?

The protected parts are where there pee would hit the pants. A boy's Pull-Ups has the protected area where his penis would rest against since he would pee from his penis. A girl's pull up has the protected area where her vagina would rest against because she would pee from a hole right above her vagina.


How does it feel for a man to put penis in girl?

It feels amazing for the boy and girl. It can be uncomfortable for a bit but feels fantastic after a while. Remember to feel the girl's boobs and let the girl suck your penis and suck her vagina.


Can a girl get pregnant if her bottoms where off but her boyfriends pants where on and they dry humped and there was pre-ejaculate. can it come through the pants?

no


How do you get to feel a girls vagina?

You can start out as loving on the girl then get to where she is comfortable then get her clothes off then you can feel and lick or kiss it all u want


Does a girl feel shy if she has hairs all over her vagina?

no not at all thxzz for asking -from the board of wk


How do boys finger girls?

through their butcrack but it does not feel as good


How do girls get a camel toe?

When your shorts are riding up or your just wearing them too high, and your shorts hug your woman parts and it looks like a camel-toe. :)


How do you become a womanizer?

you are a girl then you go through puberty and have your period that's when you bleed out of your vagina


Can a girl get pregnant by chewing man's penny through her mouth?

No it needs to tavel through the vagina in order for this to happen....chichi


What is a girl's pussie?

I'm unable to provide explicit content. If you have any other questions, feel free to ask.


Can a man come through his pants and through a girl's underwear?

Gawd, I hope so. I've been coming through girls underwear for years.

Trending Questions
1 Describe the ionic events underlying the nerve action potential 2. Describe the steps in cross bridge cycle that produces skeletal muscle contraction.? Altitudinal zonation is describing how climate changes with? What is the tibia also known as? What organism feed on each other? What are the three fields that collaborate today to explain evolution? What happens if a cell does not pass the g1 checkpoint? What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg? Why are living things called the basic building blocks of life? What are enzymes called because they affect the speed of chemical reaction without being consumed? Francesco Redi conducted an experiment to test the hypothesis that maggots arose spontaneous generation. what prediction did he make in designing his experiment? Do the locations of derived characters on a cladogram show? What is the difference between phenotypes and genotypes? What are three reasons mendel chose pea plants for his experiments? Model organisms are used to test hypotheses? What is the name of the gas that the body must be supplied with to function? What are saclike outpocketings of the large intestine wall? What's it called when you have ringing in your ears, and what are the common causes of this condition? A red blood cell will shrink in size when placed in a more concentrated salt solution because of the passive process called? Is the movement of water in a hypertonic solution from a high concentration to a low concentration? Are tiny black bugs in the house harmful or just a nuisance?