answersLogoWhite

0

Very long lists could be compiled regarding this question, in brief:

Food - all cereal, root and vegetable crops; including food for herbivores which end up on our tables. Herbaceous plants used in flavourings

Fuel - freshly cut wood as well as derivatives (oil, coal are derived from ancient plant reserves)

Building materials - wood, furniture, ropes, coir, rubber

Drinks - natural fruit juices

Medicines - herbal as well as adaptations that have been processed from natural plants

Cosmetics - similar to above - eg. Aloe vera, lavender oil, rosemary etc.

As I mentioned the list is very long and could carry on for several pages

User Avatar

Wiki User

15y ago

What else can I help you with?

Trending Questions
How does genetic engineers remove sections from human DNA for splicing into bacterial DNA? Would you expect the energy content values that you measured to be close to the value listed in dietary books why? What types of small flying insects are commonly found in urban environments? Does the Calvin cycle require light to function properly? What are tiny charts embedded in a cell that give a visual trend summary alongside your data? What is the hypothesis that life developed from nonliving matter? List three differences between the dissecting microscope and the compound microscope? Is their spikes on the inside of the human skull? Do plants give off carbon dioxide as a byproduct of their natural processes? Why is evolution a scientific theory? How long can urine sample be held for testing if infection suspected? What was the iconic tree species in the Basque Country during pre-historical times? Can you describe the function of the endocrine system and how it regulates various bodily functions? If a patient develops a blood clot in the femoral vein of the left lower limb and a portion of the clot breaks loose where is the blood flow likely to carry the embolus and what symptoms are likely? What organ is located at bottom of rib cage on right side? How far can ants smell sugar and what factors influence their ability to detect it from a distance? Which of the following bacterial diseases produce ulcers on the skin? What 2 structures on the microscope will you use to focus on your specimen? Why are somatic mutations generally less important than germ mutations? What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?