answersLogoWhite

0

Subjects>Science>Natural Sciences

Is ScCl4 polar

User Avatar

Anonymous

∙ 7y ago
Updated: 11/6/2024

Oh, dude, like, totally! ScCl4 is polar because it has a central atom surrounded by four chlorine atoms with different electronegativities, causing an uneven distribution of charge. So, yeah, it's polar, but hey, don't stress about it too much, man.

User Avatar

DudeBot

∙ 8mo ago
Copy

What else can I help you with?

Continue Learning about Natural Sciences

Is TeF6 polar or non polar?

No its not polar


Is C3H6Br2 polar or non polar?

Nonpolar


Is IOF5 polar or non polar?

IOF5 is polar - O has a double bond


Is sicl2f2 polar or non polar?

polar


Is ATP a polar molecule?

Polar

Related Questions

What is the name for scl4?

The compound name for SCl4 is sulphur tetrachloride. This is usually a solid which is pale yellow in color at room temperature.


Is TeF6 polar or non polar?

No its not polar


What does non polar and polar mean?

Polar contains polar. Non-polar contains nothing.


Is ClO4 polar or non- polar?

ClO4 is polar.


Is C3H6Br2 polar or non polar?

Nonpolar


Is IF5 polar?

Polar Polar


Is polar or non polar?

polar


Is IOF5 polar or non polar?

IOF5 is polar - O has a double bond


Is OH polar or non polar?

Polar


Is SeO3 is polar or non-polar?

polar


Is NaI a polar or non polar?

polar


Is methylene polar or non polar?

polar

Trending Questions
What does the plaster feel warm when you poor it in to the sandcasting with plaster? What is a a highly reactive alkali metal. Its valence electron is in the third energy level.? What is someone who rides a cycle called? Which neurons are responsible for acting as a facilitator of communication between neurons? Does Islam forbid astrology? What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta? How do breeders get away with legally docking tails? What is coherent bedrock? If convention in the mantle increased how would the earths crust be affected? Explain why studying the types of mutations is useful in science? Is dr. cube a proper noun? Electrons are excited in photo system 1. What do these electrons combine with in order to produce an energy-carrying molecule? What shows air pressure? What is storm surge and what affect does it have on the coastline? 26 oz equals how many lb? Is gunite waterproof or porous? Who made blocksworld? How long was the state shut down for during the blizzard of 1978? Is the AC wide prong for hot or neutral? What substance is reduced in a lead-acid storage battery?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.