Results for telomere
On this page:
 
Dictionary:

telomere

  (tĕl'ə-mîr', tē'lə-) pronunciation
n.

Either of the sections of DNA occurring at the ends of a chromosome.


 
 
Genetics Encyclopedia: Telomere

Telomeres are structures found at the ends of chromosomes in the cells of eukaryotes. Telomeres function by protecting chromosome ends from recombination, fusion to other chromosomes, or degradation by nucleases. They permit cells to distinguish between random DNA breaks and chromosome ends. They also play a significant role in determining the number of times that a normal cell can divide. Unicellular forms whose cells have no true nuclei (prokaryotes) possess circular chromosomes that, therefore, have no ends. Thus, prokaryotes can have no telomeres.

Structure

Telomeres are extensions of the linear, double-stranded DNA molecules of which chromosomes are composed, and are found at each end of both of the chromosomal strands. Thus, one chromosome will have four telomeric tips. In humans, the forty-six chromosomes are tipped with ninety-two telomeric ends.

In most eukaryotic forms, telomeres consist of several thousand repeats of the specific nucleotide sequence TTAGGG and occur in organisms ranging from slime molds to humans. The entire length of repeated telomere sequences is known as the terminal restriction fragment (TRF). Sequences different from TTAGGG are found in more primitive eukaryotic forms, such as the ciliated protozoan Tetrahymena, in which Elizabeth Blackburn first characterized the repeated telomere sequence.

The polymerases that copy the chromosomes of DNA strands are unable to copy completely to the end. This became known as the "end-replication problem" when it was first recognized in the late 1960s. The TRF acts like a buffer that protects the information-containing genes, so that the loss of some telomeric nucleotide sequences at each round of DNA replication does not result in the loss of genetic information. The telomeres themselves end in large duplex loops, called T-loops.

A Simple Counting Mechanism

For the first half of the twentieth century it was believed that cells cultured in laboratory glassware could replicate indefinitely if the correct nutrient media and other conditions of growth could be found. Repeated initial failure at culturing indefinitely replicating cells was followed by success in the late 1940s, when the immortal L929 cancer cell population was developed from mouse tissue. Later, other immortal cell populations were found, including the first human cell line, HeLa, derived from a human cervical carcinoma.

It was originally, but erroneously, believed that normal cells also had the potential to divide and function indefinitely in culture, and so it was thought that aging could not be the result of events that occurred within normal cells. Instead, aging was thought to be the result of extracellular events such as radiation or of changes in the extracellular molecules that cement cells to each other.

In 1960, however, it was discovered that no culture conditions exist that will permit normal human cells to divide indefinitely. Rather, cells were found to have a built-in counting mechanism, called the Hayflick Limit, that limits their capacity to replicate. For example, human fibroblast cell populations, found in virtually all tissues, will double only about 50 times in culture when derived from fetal tissue. Fibroblast populations from older adults double fewer times, the exact number of doublings depending upon the age of the donor. Leonard Hayflick and P. S. Moorhead also suggested that only abnormal or cancer cells divide indefinitely. They theorized that the limited capacity for normal cells to divide is an expression of aging and that it determines the longevity of the organism.

In support of this theory, it was found that frozen normal fetal cells "remember" the doubling level at which they were frozen and, after thawing, will undergo additional doublings until the total of fifty is reached. These facts suggested to Hayflick that a replication-counting mechanism existed. Hayflick and coresearcher Woodring Wright later found that this mechanism was located in the nucleus of the cell.

The Discovery of Telomeres

The search for the molecular counting mechanism ended when Calvin Harley and Carol Greider discovered that the telomeres of cultured normal human fibroblasts become shorter each time the cells divide. When telomeres reach a specific short length, they signal the cell to stop dividing. Therefore, cellular aging, as marked by telomere shortening, is not based on the passage of time. Instead, telomere loss measures rounds of DNA replication. For this reason, Hayflick has coined the term "replicometer" for this mechanism.

An accumulation of evidence suggests that while telomere attrition explains the loss of replicative capacity in normal cells, the process may not be as simple as first believed. There are several essential DNA-binding proteins (for example, TRF1 and TRF2) associated with telomeres, and the role that they play in capping and uncapping the telomere ends undoubtedly will be found to complicate the oversimplified explanation given above.

Telomerase

Immortal cancer cells escape telomere loss by switching on a gene that expresses an enzyme called telomerase. This unusual enzyme is a reverse transcriptase that has an RNA template and a catalytic portion. At each round of DNA replication, telomerase adds onto the existing telomeres the nucleotides that would otherwise have been lost, thus maintaining a constant telomere length. In other words, telomerase acts as an "immortalizing" enzyme. In addition, it has several associated proteins whose roles are still under investigation.

Using what is called the TRAP assay (telomeric repeat amplification protocol), it has been found that about 90 percent of all human tumors produce telomerase, whereas the only normal adult somatic cells that produce telomerase are stem cell populations found, for example, in skin, the hematopoietic system, germ cells, and gut epithelia. In fact, the presence or absence of telomerase is the most specific property that distinguishes cancer cells from normal cells. This difference is currently under investigation as a diagnostic tool. If a chemical could be found to interfere with telomerase activity in cancer cells, an effective control of this disease might be found. Several candidate substances have been identified and are undergoing extensive studies in animals.

Telomerase is switched on in virtually all human cells at the moment of conception, but as the embryo matures the telomerase becomes repressed in all but the germ cells and stem cell populations. Further, the level of telomerase expressed in stem cells is much less than that expressed in cancer cells. Interestingly, telomerase expression has been found to occur in all the cells of animals that age slowly or not at all. These are animals, such as the American lobster and the rainbow trout, that do not stabilize at a fixed size in adulthood.

On the human genome, an enzyme known as human telomerase reverse transcriptase (hTERT) is found on the most distal gene on chromosome 5p. The transfection (introduction) of hTERT into cultured normal human fibroblasts has resulted in telomere elongation, telomerase expression, and the immortalization of these otherwise mortal cells. After several hundred population doublings, the transfected cells exhibit some drift from the diploid number of chromosomes but cancer cell properties do not occur. This experiment proves that telomerase is not a cancer enzyme but an immortalization enzyme. The ability to immortalize normal human cells via hTERT has important potential applications. Some immortalized cells could be cultured in the lab to produce therapeutically useful molecules. Others might be used directly within the body to repair tissue or replace lost or damaged cells.

Bibliography

Bodnar, A. G., et al. "Extension of Life Span by Introduction of Telomerase intoNormal Human Cells." Science 279 (1998): 349-352.

Greider, Carol W. "Telomeres and Senescence: The History, the Experiment, the Future." Current Biology 8 (1998): 178-181.

Hayflick, Leonard. How and Why We Age. New York: Ballantine Books, 1996.

———. "The Illusion of Cell Immortality." British Journal of Cancer 83 (2000):841-846.

—Leonard Hayflick

 
Science Dictionary: telomere
(tel-uh-meer)

The long end sequences of a DNA strand occurring at the tip of the chromosomes; a type of repetitive DNA that usually consists of one hundred to fifteen hundred copies of a single DNA sequence.

  • During DNA replication, small parts of the telomere are lost with each cycle. Scientists think that this loss may be related to the aging process.

    •  
    Veterinary Dictionary: telomere

    An extremity of a chromosome, which has specific properties, one of which is a polarity that prevents reunion with any fragment after a chromosome has been broken.

     
    Wikipedia: telomere

    A telomere is a region of highly repetitive DNA at the end of a linear chromosome that functions as a disposable buffer. Every time linear chromosomes are replicated during late S phase, the DNA polymerase complex is incapable of replicating all the way to the end of the chromosome; if it were not for telomeres, this would quickly result in the loss of vital genetic information, which is needed to sustain a cell's activities. Every time a cell with linear chromosomes divides, it will lose a small piece of one of its strands of DNA. This process has been referred to by James Watson and Alexei Olovnikov as the "end replication problem" (1971). It is believed that telomeres have a function in the ageing process.

    Nature and function of telomeres

    Telomerase is a "ribonucleoprotein complex" composed of a protein component and an RNA primer sequence which acts to protect the terminal ends of chromosomes. This is because during replication, DNA polymerase can only synthesize DNA in a 5'to 3'direction and can only do so by adding polynucleotides to an RNA primer that has already been placed at various points along the length of the DNA. These RNA strands must later be replaced with DNA. At the terminal of the DNA strand, the RNA primer is laid but DNA polymerase cannot extend beyond it. This RNA primer will not later be replaced by DNA, and therefore cannot be translated into gene products or replicated later. Without telomeres at the end of DNA, this genetic sequence would be deleted and the chromosome would grow shorter and shorter in subsequent replications. The telomere prevents this problem by employing a different mechanism to synthesize DNA at this point, thereby preserving the sequence at the terminal of the chromosome. This prevents chromosomal fraying and prevents the ends of the chromosome from being processed as a double strand DNA break, which could lead to chromosome-to-chromosome telomere fusions. Telomeres are extended by telomerases, part of a protein subgroup of specialized reverse transcriptase enzymes known as TERT (TElomerase Reverse Transcriptases) that are involved in synthesis of telomeres in humans and many other, but not all, organisms. However, because of DNA replication mechanisms and because TERT expression is repressed in many types of human cells, the telomeres of these cells shrink a little bit every time a cell divides although in other cellular compartments which require extensive cell division, such as stem cells and certain white blood cells, TERT is expressed and telomere length is maintained.

    Structure of parallel quadruplexes that can be formed by human telomeric DNA. Image created from NDB UD0017.
    Enlarge
    Structure of parallel quadruplexes that can be formed by human telomeric DNA. Image created from NDB UD0017.

    In addition to its TERT protein component, telomerase also contains a piece of template RNA known as the TERC (TElomerase RNA Component) or TR (Telomerase RNA). In humans, this TERC telomere sequence is a repeating string of TTAGGG, between 3 and 20 kilobases in length. There are an additional 100-300 kilobases of telomere-associated repeats between the telomere and the rest of the chromosome. Telomere sequences vary from species to species, but are generally GC-rich. These GC-rich sequences can form four-stranded structures (G-quadruplexes), with sets of four bases held in plane and then stacked on top of each other with either a sodium or potassium ion between the planar quadruplexes.

    In most prokaryotes, chromosomes are circular and thus do not have ends to suffer premature replication termination. A small fraction of bacterial chromosomes (such as those in Streptomyces and Borrelia) are linear and possess telomeres, which are very different from those of the eukaryotic chromosomes in structure and functions.

    In most multicellular eukaryotes, telomerase is only active in germ cells. There are theories that the steady shortening of telomeres with each replication in somatic (body) cells may have a role in senescence and in the prevention of cancer. This is because the telomeres act as a sort of time-delay "fuse", eventually running out after a certain number of cell divisions and resulting in the eventual loss of vital genetic information from the cell's chromosome with future divisions.

    If telomeres become too short, they will potentially unfold from their presumed closed structure. It is thought that the cell detects this uncapping as DNA damage and will enter cellular senescence, growth arrest or apoptosis depending on the cell's genetic background (p53 status). Uncapped telomeres also result in chromosomal fusions. Since this damage cannot be repaired in normal somatic cells, the cell may even go into apoptosis. Many aging-related diseases are linked to shortened telomeres. Organs deteriorate as more and more of their cells die off or enter cellular senescence.

    At the very distal end of the telomere is a 300 bp single-stranded portion which forms the T-Loop. This loop is analogous to a 'knot' which stabilizes the telomere; preventing the telomere ends from being recognized as break points by the DNA repair machinery. Should non-homologous end joining occur at the telomeric ends, chromosomal fusion will result. The T-loop is held together by seven known proteins; most notably TRF1, TRF2, POT1, TIN1, and TIN2.

    A study published in the May 3, 2005 issue of the American Heart Association journal Circulation found that weight gain and increased insulin resistance were correlated with greater telomere shortening over time.

    Telomere shortening

    Lagging strand during DNA replication
    Enlarge
    Lagging strand during DNA replication

    "Telomeres" shorten because of the end replication problem that is exhibited during DNA replication in eukaryotes only. Because DNA replication does not begin at either end of the DNA strand, but starts in the center, and considering that all DNA polymerases that have been discovered move in the 5' to 3' direction, one finds a leading and a lagging strand on the DNA molecule being replicated.

    On the leading strand, DNA polymerase can make a complementary DNA strand without any difficulty because it goes from 5' to 3'. However, there is a problem going in the other direction on the lagging strand. To counter this, short sequences of RNA acting as primers attach to the lagging strand a little way ahead of where the initiation site was. The DNA polymerase can start replication at that point and go to the end of the initiation site. This causes the formation of Okazaki fragments. More RNA primers attach further on the DNA strand and DNA polymerase comes along and continues to make a new DNA strand.

    Eventually, the last RNA attaches, and DNA polymerase and DNA ligase come along to convert the RNA (of the primers) to DNA, and seal the gaps in between the Okazaki fragments. But in order to change RNA to DNA, there must be another DNA strand in front of the RNA primer. This happens at all the sites of the lagging strand, but it doesn't happen at the end where the last RNA primer is attached. Ultimately, that RNA is destroyed by enzymes that degrade RNA left on the DNA. Thus, a section of telomeres is lost during each cycle of replication at the 5' end of both the leading and lagging strands.

    Extending telomeres

    The phenomenon of limited cellular division was first observed by Leonard Hayflick. Significant discoveries were made by the team led by Professor Elizabeth Blackburn at the University of California - San Francisco.

    Advocates of human life extension promote the idea of lengthening the telomeres in certain cells through temporary activation of telomerase (by drugs), or possibly permanently by gene therapy. They reason that this would extend human life. So far these ideas have not been proven in humans.

    However, it has been hypothesized that there is a trade-off between cancerous tumor suppression and tissue repair capacity, and that by lengthening telomeres we might slow aging and in exchange increase vulnerability to cancer (Weinstein and Ciszek, 2002).

    A study done with the nematode worm species Caenorhabditis elegans indicates that there is a correlation between lengthening telomeres and a longer lifespan. Two groups of worms were studied which differed in the amount of the protein HRP-1 their cells produced, resulting in telomere lengthening in the mutant worms. The worms with the longer telomeres lived 24 days on average, about 20 percent longer than the normal worms. A side effect of the mutation was an increased resistance to the effects of heat exposure. The reasons for that effect are unclear. (Joeng et al., 2004).

    Techniques to extend telomeres could be useful for tissue engineering, because they might permit healthy, noncancerous mammalian cells to be cultured in amounts large enough to be engineering materials for biomedical repairs.

    However, there are several issues that still need to be cleared up. First, it is not even certain whether the relationship between telomeres and aging is causal. Although this is indeed probably so because changing telomere lengths are usually associated with changing speed of senescence, the relationship may well be the other way around, with telomere shortening a consequence of and not a reason for aging. That the role of telomeres is far from being understood is demonstrated by two recent studies on long-lived seabirds:

    In 2003, scientists observed that the telomeres of Leach's Storm-petrel (Oceanodroma leucorhoa) seem to lengthen with chronological age, the first observed instance of such behaviour of telomeres[1]. In 2006, Juola et al. reported that in another, unrelated long-lived seabird species, the Great Frigatebird (Fregata minor), telomere length did decrease until at least c.40 years of age (i.e. probably over the entire lifespan), but the speed of decrease slowed down massively with increasing ages, and that rates of telomere length decrease varied strongly between individual birds. They concluded that in this species (and probably in frigatebirds and their relatives in general), telomere length could not be used to determine a bird's age sufficiently well. Thus, it seems that there is much more variation in the behavior of telomere length than initially believed, and more research into the topic is clearly warranted before any firm conclusions can be drawn or even practical applications tested.

    Telomere Length Assay

    Several techniques are currently employed to assess average telomere length in eukaryotic cells. The most widely used method is the Terminal Restriction Fragment (TRF) southern blot which involves hybridization of a radioactive 32P-(TTAGGG)n oligonucleotide probe to Hinf / Rsa I digested genomic DNA embedded on a nylon membrane; and subsequently exposed to autoradiographic film or phosphoimager screen. Another histochemical method involves fluorescent in situ hybridization (FISH). These methods however, require significant amounts of genomic DNA (2-20 micrograms) and labor which renders its use limited in large epidemiological studies. These impediments have been overcome with a novel Real-Time PCR assay for telomere length developed by Richard Cawthon at the University of Utah. This assay involves determining the Telomere-to-Single Copy Gene (T/S)ratio which is demonstrated to be proportional to the average telomere length in a cell (Cawthon 2002). The Real-Time PCR assay has been since redeveloped in a high-throughput 384-well format for use with an Applied Biosystems 7900HT by Jason Wong of the Brigham and Women's Hospital / Harvard Medical School; making the assay feasible for use in large cohort studies. The high-throughput assay has been brought into large epidemiology investigations on genomic DNA samples from healthy subjects by Andrea Baccarelli's lab at the University of Milan.

    Telomere sequences

    Some known telomere sequences
    Group Organism Telomeric repeat (5' to 3' toward the end)
    Vertebrates Human, mouse, Xenopus TTAGGG
    Filamentous fungi Neurospora crassa TTAGGG
    Slime moulds Physarum, Didymium TTAGGG
    Dictyostelium AG(1-8)
    Kinetoplastid protozoa Trypanosoma, Crithidia TTAGGG
    Ciliate protozoa Tetrahymena, Glaucoma TTGGGG
    Paramecium TTGGG(T/G)
    Oxytricha, Stylonychia, Euplotes TTTTGGGG
    Apicomplexan protozoa Plasmodium TTAGGG(T/C)
    Higher plants Arabidopsis thaliana TTTAGGG
    Green algae Chlamydomonas TTTTAGGG
    Insects Bombyx mori TTAGG
    Roundworms Ascaris lumbricoides TTAGGC
    Fission yeasts Schizosaccharomyces pombe TTAC(A)(C)G(1-8)
    Budding yeasts Saccharomyces cerevisiae TGTGGGTGTGGTG (from RNA template)
    or G(2-3)(TG)(1-6)T (consensus)
    Candida glabrata GGGGTCTGGGTGCTG
    Candida albicans GGTGTACGGATGTCTAACTTCTT
    Candida tropicalis GGTGTA[C/A]GGATGTCACGATCATT
    Candida maltosa GGTGTACGGATGCAGACTCGCTT
    Candida guillermondii GGTGTAC
    Candida pseudotropicalis GGTGTACGGATTTGATTAGTTATGT
    Kluyveromyces lactis GGTGTACGGATTTGATTAGGTATGT

    Telomeres and cancer

    Telomere maintenance activity is a hallmark in approximately 90% of cancers in almost all mammalian organisms. In humans, cancerous tumors acquire indefinite replicative capacity by over-expressing telomerase. However, a sizeable fraction of cancerous cells employ alternative lengthening of telomeres (ALT), a non-conservative telomere lengthening pathway involving the transfer of telomere tandem repeats between sister-chromatids. The mechanism by which ALT is activated is not fully understood because these exchange events are difficult to assess in vivo.

    References

    • Joeng KS, Song EJ, Lee KJ, Lee J (2004). "Long lifespan in worms with long telomeric DNA". Nature Genetics 36 (6): 607-11. PMID 15122256. 
    • Juola, Frans A.; Haussmann, Mark F.; Dearborn, Donald C.; Vlek, Carol M. (2006): Telomere shortening in a long-lived marine bird: Cross-sectional analysis and test of an aging tool. Auk 123(3): 775–783. DIO: 10.1642/0004-8038(2006)123[775:TSIALM]2.0.CO;2 HTML abstract

    Related papers

    External links

    Genetics: chromosomes


    This entry is from Wikipedia, the leading user-contributed encyclopedia. It may not have been reviewed by professional editors (see full disclaimer)

     
     

    Join the WikiAnswers Q&A community. Post a question or answer questions about "telomere" at WikiAnswers.

     

    Copyrights:

    Dictionary. The American Heritage® Dictionary of the English Language, Fourth Edition Copyright © 2007, 2000 by Houghton Mifflin Company. Updated in 2007. Published by Houghton Mifflin Company. All rights reserved.  Read more
    Genetics Encyclopedia. Genetics. Copyright © 2003 by The Gale Group, Inc. All rights reserved.  Read more
    Science Dictionary. The New Dictionary of Cultural Literacy, Third Edition Edited by E.D. Hirsch, Jr., Joseph F. Kett, and James Trefil. Copyright © 2002 by Houghton Mifflin Company. Published by Houghton Mifflin. All rights reserved.  Read more
    Veterinary Dictionary. Saunders Comprehensive Veterinary Dictionary 3rd Edition. Copyright © 2007 by D.C. Blood, V.P. Studdert and C.C. Gay, Elsevier. All rights reserved.  Read more
    Wikipedia. This article is licensed under the GNU Free Documentation License. It uses material from the Wikipedia article "Telomere".  Read more

    Search for answers directly from your browser with the FREE Answers.com Toolbar!  
    Click here to download now. 

    Get Answers your way! Check out all our free tools and products.

    On this page:   E-mail   print Print  Link  

     

    Keep Reading

    Mentioned In:

     |  More >More >

    Related Topics