0
What else can I help you with?
Related Questions
Was King Henry vii inventor?
King Henry the 7th was not known for any inventions nor Henry the 8th. However, Henry the 8th did compose music.
Who is the famous king?
The most famous king is king Henry 8th.
What is King Henry you famous for?
king Henry the 8th was famous for having six wife's and killing them.
What did King Henry the 8th become?
...Fat....
Who is the most famous king?
The most famous king is king Henry 8th.
When did Henry 8th die in hosss?
King Henry VIII died in 1547.
What was King Henry 8th personality like?
MOODY
How old was King Henry the 8th at ascent?
17
What did Henry the 8th have in common with king john?
Gout
Why did King Henry 8th get his money?
stael it from the bank
Did Catherine and King Henry the 8th have a girl?
Yes.
When did Henry the 8 marry Jane seymore?
Jane Seymour was born in 1508, and married King Henry VIII on 30 May 1536. She was 28 when she married him.
Trending Questions
What should you do to leave merry-go-round in order not to fall down?
What is the meaning of the laundry pin on a bikers jacket?
What is the chemical that blocks most of the ultraviolet light from reaching earth?
How many ATM of pnb in kolkata?
Im almost 15 and im 5'2 most of my friends are taller than me am i under the average do you think?
What are the complementary bases for the following DNA strand aatggccttagcagttgcatga?
What is the last sense to leave the body when you die?
How did Girl Guides begin?
What was one of the archangels named in the Hebrew tradition?
Why is RNA needed in a cell?
Where did endless shoes come from?
Why did the US intervene in the Mexican Revolution?
How much did Turtle win in the Westing Game?
Why did New Zealand john walker become a athlete?
How willu obtain butan-2-ol from propanal?
How do you get on top of Hideki tower on Skate 2 for Xbox 360?
When did Samuel Tertius Galton die?
Where can you buy vernors in Michigan?
What is the largest nuclear charge of group 2?
Does Connecticut have a football team?
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.