0
Cuncumers
What else can I help you with?
Related Questions
Are foxes producers consumers or decomposes?
Almost all animals are consumers. Only plants and some protists produce their own food from light. Decomposers break down dead tissue - fungi, bacteria, certain insects and snails are considered decomposers. Foxes are mammals so they are consumers.
How do most foxes die?
It dies and then decomposes.
What consumer are foxes?
Foxes are secondary consumers.
Are owls consumers or decomposes?
Owls are consumers, because they have to find their food.
Are Arctic foxes secondary consumers?
Yes, Arctic foxes are secondary consumers as well as omnivores.
Are foxes consumer?
Foxes are secondary consumers.
What decomposes a raccoon?
Raccoons are not decomposers, they are consumers.
Is a squirrel a producer consumer or a decomposes?
Consumer
What organisms in a balanced aquarium are consumers?
consumers eat other things so fish or decomposes such as snails
Is a fox a consumers?
Yes, foxes are consumers. All animals are consumers. Only plants are producers.
Consumers such as foxes can also be referred to as?
Carnivores
How are foxes consumers?
they eat (consume) mice.
Trending Questions
What document approved by 13 states was established the first government in 1781?
Longest wavelength in the spectrum of color?
What was the most important medium for Tin Pan Alley songs at the turn of the Century?
What does the name Safora mean?
What is the definition of a quarter moon?
What is the centre of culture?
What are the codons and anticodons for the sequence auguucguuaacgaccaaauuuaa?
Who was the commanding officer union during the battle of Gettysburg?
Is the radium Paint in a compass dangerous?
How do you pronounce the brand of sunglasses called Costa?
Did the Philippines fight in World War 2?
Hindu goddess of the Earth?
What could be considered a reliable source of scientific information?
How did rev run and kid rock become friends?
Which dosage is stronger 160 mcg or 220 mcg?
Who said liberty consists in doing what one desires?
Which religious group primarily settled in Pennsylvania?
How do you get off the help menu pokemon fire red pc?
Can Catholics be single?
Why is there no power to the ignition switch?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.