answersLogoWhite

0

Can you cure the plauge

User Avatar

Anonymous

∙ 14y ago
Updated: 8/17/2019

no

User Avatar

Wiki User

∙ 14y ago
Copy

What else can I help you with?

Related Questions

How did the people of the 17th century cure the plauge?

there was no cure,


Plauge Cure's in the Elizabethan era?

Tom Collingwood!!


What were the plauge remidies?

Some people thought that if you hold herbs up to your nose it would prevent getting it but until antibiotics were created there was no actual cure for somebody who had the plauge


Where did the black plauge originate?

It started in Spain :) It first started in Asia, but then it went to Europe. It started up again in India in 1900's but they made a cure for it


What was the second Plauge?

the second plauge was frogs invading Egypt


How many years was the plauge around for?

the plauge was first dicoverd in 1661


What was the cure for the Bubonic Plauge?

To be honest i don't think their is a cure. I know a solution was to incinerate the bodies to prevent farther spread. And staying away from people was usual.


Where is the black plauge?

The black plauge was from Europe and spread all the way to cover half of Asia it went that far. But now there is no Black Plauge it ended in about the 15 century. I don't know exacly where the Black Plauge started though.


What did the plauge do?

it killed thousands of people


What rhymes with vague?

Plauge


How did the plauge affect constintanople?

wiped them out


How Titian died?

Th bubonic plauge .

Trending Questions
What jobs do German shepherds do? What is that violent disturbance in the atmosphere? What is spiritual tradition? Is speeding a felony? Are grow lights harmful to humans and if so, what are the potential risks associated with their use? How was lineage important to West native African societies? Why might an author choose t use a first person narrator? How many starburst candy can fit in a 16 oz jar? Safeway carries twinkle silver polish? Is Louis single? Is there a cheat code for Pokemon ruby to get Rayquaza Groudon or Kyogre as the starters? What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg? Where is the glow plugs on 1999 F250 7.3 diesel? What is the main concern of the writer? What happened on April 25th 1994? How did ladd russo become immortal? When was LNWR Dock Tank created? How can I effectively clean and sanitize bath toys, ensuring they are safe for my child to play with? What is valve class? What would happen if decomposition did not occur?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.