DNA can be found on any part of the body. My best bet would be to get a piece of hair.
Get something with his DNA on it, like hair from his hairbrush. It has to have the roots still on it.
You have to study business policy if you wish to start your own business and join a new venture as partner or vice versa. Without knowing the knitty gritty of the business, your decision should be like diving into the river without knowing swimming.
He discovered the structure of DNA with his partner James Watson
They predicted that the DNA double helix would unzip and replicate semiconservatively.
Yes, it is possible for you to conduct a DNA test on your partner's child to determine biological parentage.
Thymine, T, pairs with adenine, A, and cytosine, C, pairs with guanine, G. So, the partner DNA of TACGTATTTAGCCCCTGCTTT, is ATGCATAAATCGGGGACGAAA.
Yes, all you need is something with his DNA on it like a hair with the roots still on it from his hairbrush for instance.
Only the legal guardian can give consent to a medical procedure. If she says no you can get a court order.
No the sperm of the person you are having sex with while pregnant will have no effect at all on the baby.
the portion of DNA given by the male partner
If you can get a swab from the inner cheek of the mouth and put it into a sterile tube, you can get it checked out. But..there may be legal reasons you should look into first.
Yes, you can still love a partner even if you think he gave you chlamydia. In a new relationship, it's not unusual for one partner to have chlamydia without knowing, and to transmit it to a partner. On the other hand, if you think he may be unfaithful and putting you at risk for STDs without your knowledge, you'll have to consider your own health and safety from continuing to have sexual contact with him.