answersLogoWhite

0

DNA can be found on any part of the body. My best bet would be to get a piece of hair.

User Avatar

Wiki User

12y ago

What else can I help you with?

Related Questions

How can you do a paternity test without man knowing?

Get something with his DNA on it, like hair from his hairbrush. It has to have the roots still on it.


Why do you have to study business policy?

You have to study business policy if you wish to start your own business and join a new venture as partner or vice versa. Without knowing the knitty gritty of the business, your decision should be like diving into the river without knowing swimming.


How did Watson and crick come up with a hypothesize of DNA replication?

They predicted that the DNA double helix would unzip and replicate semiconservatively.


What did francis crick do and who was his partner?

He discovered the structure of DNA with his partner James Watson


Is it possible for me to conduct a DNA test on my partner's child?

Yes, it is possible for you to conduct a DNA test on your partner's child to determine biological parentage.


What is the partner dna of tacgtatttagcccctgcttt?

Thymine, T, pairs with adenine, A, and cytosine, C, pairs with guanine, G. So, the partner DNA of TACGTATTTAGCCCCTGCTTT, is ATGCATAAATCGGGGACGAAA.


Can you take a peternity test without the father knowing?

Yes, all you need is something with his DNA on it like a hair with the roots still on it from his hairbrush for instance.


Can ex partner take DNA test without mothers consent?

Only the legal guardian can give consent to a medical procedure. If she says no you can get a court order.


If you have a different sex partner while pregnant does the DNA of the child change without protection?

No the sperm of the person you are having sex with while pregnant will have no effect at all on the baby.


How do you do a prenatal DNA at home without him knowing?

If you can get a swab from the inner cheek of the mouth and put it into a sterile tube, you can get it checked out. But..there may be legal reasons you should look into first.


What is the x chromosone?

the portion of DNA given by the male partner


Can you still love him even though you think he gave you chlamydia?

Yes, you can still love a partner even if you think he gave you chlamydia. In a new relationship, it's not unusual for one partner to have chlamydia without knowing, and to transmit it to a partner. On the other hand, if you think he may be unfaithful and putting you at risk for STDs without your knowledge, you'll have to consider your own health and safety from continuing to have sexual contact with him.