0
What else can I help you with?
Related Questions
When was Knoebels Amusement Resort created?
Knoebels Amusement Resort was created in 1926.
When did knoebels open?
Knoebels opened on July 4th, 1926 in elysburg pennsylvania
What is Knoebels Amusement Resort's motto?
The motto of Knoebels Amusement Resort is 'Its My Kind of Fun !'.
How many people visit Knoebels?
Knoebels Amusement Resort in Pennsylvania attracts over 1 million visitors annually.
Was knoebels bought by a larger company?
no
Where is knoebels located?
Elysberg, Pennsylvania
Where can you get discount tickets for knoebels?
May
How much is a handstamp at knoebels?
40$ each
Are swimming trunks permitted at knoebels?
yeah
What time does knoebels open?
What time does knobles open
Is there any hauntings at Knoebels?
there's a haunted mansion
Do they sell hermit crabs at knoebels?
no they could but they don't
Trending Questions
Was Saint Patrick an Italian?
If your mother is mixed and your dad is black does that mean you are mixed?
Why is Charles Darwin on the back of a Bank of England Ten Pound note?
What strong and haunting realization scares Cole more than anything else?
What is the thickest layer?
Is the song Sometimes by Step by Rich Mullins public domain?
What is the expanded form of 22.361?
Will a 2 year old boy that got an electrical shock be okay?
Do coyotes live in the taiga forest?
What are the names of the current Pittsburgh Steelers?
When is the best time to fold in Texas Hold'em?
How might psychological factors affect the business cycle?
When was Simmer in Your Hotseat created?
Does a weed lollipop get you high?
Why do you keep letting Muslims into the UK?
How do you draw a 179 degrees angle?
Where is OBD connector for Subaru legacy 2004?
What is expected and unexpected news?
How can you get rid of black bruise on cheeks of the face from a blow?
What are the complementary bases for the following DNA strand aatggccttagcagttgcatga?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.