0
What else can I help you with?
Related Questions
How much power does a CFL bulb use in comparison to a standard bulb?
Look at the base. The power rating will be printed there.
What is the CFL?
The CFL is the Canadian Football League. The CFL is Canada's professional football league.
Who is the founder of the CFL?
tom wright was the commissioner of the CFL
When did CFL USA end?
CFL USA ended in 1995.
When was CFL USA created?
CFL USA was created in 1993.
When was CFL on TSN created?
CFL on TSN was created in 1990.
When was CFL on CTV created?
CFL on CTV was created in 1962.
When was CFL on CBC created?
CFL on CBC was created in 1952.
Is there a CFL video game?
yes there is a cfl video game
What does T5 2 mean in Portugal?
Its an apartment with 5 bedrooms -T5, for houses its V5.
Does t5 affect the contraception pill?
No there is no correlation to T5 and oral BCP. But it does effect your thyroid.
What is the fullform of cfl?
The fulform of CFL bulbs is compact fluorecent light
Trending Questions
What is the molality of a solution made by dissolving 2 moles of NaOH in 6kg of water?
Why does joy make suds?
Why manuel v pangilinan still single?
What is the cost of becoming a teacher?
What is the plural form for words ending in ey?
What shape has exactly 2 perpendicular sides?
Who passes unemployment extensions?
What tragedy happened in space exploration in 1986?
How do i compare Britain and the 13 colonies in the mid-1700s?
Why did slavery end answers for kids?
What is the value of an HS .22 cal hand gun?
What is the mRNA strand for ggctatatcctgcgctatacgcta?
Who is the Cheerleader in nada surf's popular video?
How do I lose 2lbs a day on a 1200 calorie diet I'm a 20 year old female weight 258 also how much protein and carbs should I have everyday?
Why does George have a toothbrush sticking out of his ear in harry Potter?
What are some good ideas for tonight at home?
What do you call a fear of curtains?
In what song is the line Even Rock Hudson lost his heart to Doris Day?
What is the name of polygon with 1000 sides?
How long does radiation stay in the body after treatment?
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.