0
What else can I help you with?
Related Questions
If a puppy eats lead from a pencil will the puppy die?
no the puppy will not die, just call a vet or take it to the vet.
What is Princetons kik?
PrincetonMisfit
What is Princetons Instagram?
princemisfits
What is Princetons real bio?
his real name is jacob perez he is 14
What is Princetons real kik?
PrincetonMisfit
Can you see a picture of princetons girlfriend?
no he do not
What is princetons favorite activity?
play
How old is princetons mom?
35
When a puppy eats a bee will the puppy die?
YES the bee stings
What is princetons favorite sweet?
m&m's
Who is Princetons father?
micheal eppsw
Does Princeton have a gf?
princetons girlfriend is hope burnsworth
Trending Questions
What is the full form for SHEM?
What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta?
How does jem try to make scout feel beter after he conversation with aunt alex andra?
How much does an ounce of lawrencium cost?
What is ducktape for?
Who is martinique president?
What red gemstones can one have set in a ring?
What muscles are used doing the splits starting from standing?
What is the land area from which a stream gets water?
What is it like at Mecca?
Why does Douglass believe that people should be allowed to move freely from one country to another?
How do you use boilerplates?
What does the idiom 'In black and white' mean?
How do you put aerobe in a sentence?
What is the cost for a valve job on a 1999 GMC suburban?
Why do AC lines freeze up and how can this issue be prevented?
How many credits will FAFSA pay for?
Is France a European country?
What is the Japanese word for rabbit?
In badmintion what is a powerful downward stroke?
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.