0
Yes
she used to go with Jaden Smith but she dumped him for Ray Ray
What else can I help you with?
Related Questions
Who do reginae go with?
ray ray from mindless behavior
Who do Reginae Carter go with?
ray ray from mindless behavior
Does ray ray off of mindless behavior go out with reginae carter?
no he is 13 ans she is 10 it is a big age problem there and he loves his group and wouldn't leave it for nothing silly
How old do you have to be to go out with ray ray on mindless behavior?
u have to be 13 or older to date mindless behavior
Does reginae carter go out with roc royal off mindless behavior?
uh no datz ma man
Did ray ray from mindless behavior go out with zendaya?
Yes they do
What school does ray ray go to?
ray ray? who is ray ray [mindless behavior]
What ethnicity is Ray LaMontagne?
Ray ray from Mindless behavior? Or another ray ray well ray ray from mindless behavior is belizean indian black and some others don't believe go on youtube and watch mindless behavior in philly at a pizza party
Who go with ray ray on mindless behavior?
Nobody and if did he would go with me... Hehehe ! :))
Did ray ray from mindless behavior go out with star from OMG Girlz?
No
Did Ray Ray from Mindless Behavior go out with China Anne McClain?
No!
Do lolo off omg girl go with ray ray off mindless behavior?
no mindless behavior and omg girlz are like brother and sister
Trending Questions
What is wrong with my 2002 acura tl it sputters when I start it and stalls and then starts?
What bodies of water border Europe?
What is the definition of undegone?
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
What is the Wrigley's United Profit - Sharing Coupon Five 573243 DRV worth?
Was Odysseus friends with Achilles?
What collage did Jane Goodall go to?
Can you use one length of 3-wire cable to provide electricity to 2 separate circuits?
Are bowling pins sad when they get knocked down?
What would happen if animal testing wasnt present in a product?
When are cn blue members birthday?
How to arrange emails in chronological order?
What year was gasoline 22 cents gallon?
How many feet in eighteenth of a mile?
Is tropical soil infertile?
Vegetables are easily perishable because of their high content of?
How far does the moon travel in 24 hours?
Where is Newcastle in Dublin in Ireland?
How can you make one cut in the hexagon to make a triangle and a pentagon?
How many kilos is 32 Libras?
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.