0
Usher has 3 kids the other child name is Jasminewho lives with her mom in Baton Rouge,Louisiana.
What else can I help you with?
Related Questions
How muich kids dose usher have?
Usher has 7 kids altogether! wassup
Do does usher go out with?
usher goes out with his wife kids and friends
How many kids do usher have already?
Usher has two boys, Usher V (3) and Naviyd (2)
Does usher Raymond have kids?
Usher had two sons with his then-wife Tameka Foster
Do usher have custody of his kids?
yes
Does usher have step kids?
Yes
Do usher have two kids?
yes Usher Raymond V and Naviyd Ely Raymond
How many kids do usher have by tameka?
Usher has two boys with his then-wife Tameka Foster, Usher V (3) and Naviyd (2)
What is Usher like?
Usher has a wife, Tameka, 2 kids, usher Raymond V and Naviyd. They live in California near Fresno.
Where usher family?
Usher has a wife, Tameka, 2 kids, usher Raymond V and Naviyd. They live in California near Fresno.
Does usher have a kids by Rozonda Chilli Thomas?
No usher will never have a child he is too good for his business
Does usher love his kids and wife?
Yes.
Trending Questions
How do I turn 6.22 to a rational number?
How do you say son?
Who are helping or hurting the Amazon rain forest?
Some cheats for PS2 aerosmith?
Who was number one on march 21st 1953?
How can you find the Eulers numbers in a power series expansion of secant in complex variable?
What province is Albany city in?
How old is Sideshow Bob?
What are some codes for the code shop on webkins?
What is will ferrells favorite drink?
What is the name of a string of words starting with ph?
What is a bed that pulls down from a wall cabinet called?
What is a long spear carried by knights called imiges?
What is the complementary sequence for atgcccgggtgtcgtagttga?
The Darkness of the Night by Ribebt M Coates?
What other metals can you use for a lemon battery?
Why want your 2000 chev cavalier go in to overdrive?
What is a screen element that displays buttons for accessing office features and commands?
What you should do become a cricket commentator?
What is the rising action in ella enchanted?
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.