0
What else can I help you with?
Related Questions
Can you reserve games at gamestop if the game is not out like Naruto Ultimate Ninja 5?
Yes. just ask one gamestop person.
How do you reserve a game at Gamestop?
Well it cant be out yet just ask to reserve the game.
How do you reserve a video game?
Ask @ local GameStop
When you reserve a game. When do you pick it up at Gamestop?
give the gamestop your home phone number and they will call you the night before it comes out
How long will Gamestop hold a reserve?
I believe its 48hours (2 days) only.
When will Smackdown vs Raw 2009 come out in the US?
IN gamestop smackdown vs raw 2009 is coming out in November 9,2008 and you better reserve it. IN gamestop smackdown vs raw 2009 is coming out in November 9,2008 and you better reserve it.
How much do you reserve a game at gamestop?
He amount of the new game when it comes out
How much does Pokemon black and white cost if you reserve a copy at gamestop Canada?
$14
How much would Gamestop give someone for 2-3 xbox360 games?
It depends what the games are and each Gamestop varies. Call your local Gamestop and ask.
Which gamestops sell GameCube games?
brandon gamestop and valrico gamestop
Is Eb games the same thing as Gamestop?
Yes and no. EB games was a big company, but gamestop bought most of them out.
Does Gamestop buff games?
no
Trending Questions
Did Nixon win his election by a landslide?
One who is appreciative of art and beauty?
What is 2 to the power of 63?
Where is the freeze plug on a 1996 Chrysler Sebring Coupe 2.5?
Should you increase taxes or cut taxes?
What is meaning of powerless speech mannerisms?
What is 20-20kHZ frequency range in feet?
How do you take care of pearls?
What does straved mean?
What is mailroom services?
What is another term for a new religion?
What can you mix with tarantula tequila?
Why did William Wilberforce write the song amazing grace?
What is the gravitational condensation theory?
Is UNIX a hardware or software?
Who is Bella Thorne's mom?
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
What is Superman's real name?
If a person can't see is blind a person who can't hear is deaf what do you call a person who can't taste?
Why is cornstarch and water an emulsion?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.