answersLogoWhite

0

Does Michelle Obama like being first lady?

User Avatar

Anonymous

∙ 13y ago
Updated: 8/20/2019

Yes she does because she likes helping people in need.

User Avatar

Wiki User

∙ 13y ago
Copy

What else can I help you with?

Related Questions

Who is the first lady?

The first lady's name is Mrs. Michelle Obama Michelle Obama


Who is first lady?

The first lady's name is Mrs. Michelle Obama Michelle Obama


Who is the lady?

The first lady's name is Mrs. Michelle Obama Michelle Obama


Who is the first lady of US?

Michelle LaVaughn Robinson Obama is the First Lady.


Who was the African American first lady of the US?

Michelle Obama


What number first lady is Michelle Obama?

Michelle Obama is the 44th First Lady of the United States.


What is important to Michelle Obama?

Being the First Lady and dressing well.


What is Michelle Obama important?

Being the First Lady and dressing well.


What is Michelle's Obama Occupation?

In 2014, Michelle Obama's occupation is First Lady of the United States. Before that, she was an attorney who worked organizing communities.


Barack Obama's first lady?

it is Michelle Obama


Who is the new First Lady?

The new First Lady of the US will be Michelle LaVaughn Obama whose maiden name was Michelle Obama.


Why do they call Michelle Obama the first lady?

After the Barack Obama is sworn in as President, Michelle Obama will officially become the First Lady of the United States of America.

Trending Questions
What is 77725 rounded to the nearest hundred? List three forms of energy into which electricity energy can be changed? What is the birth name of Vadia Potenza? How do you write an absent letter to school because of music exam? How do you find frankencarot in adventurequest? What is deposit form? What is A mixture of equal amounts of two enantiomers? The Edison Electric Institute was established in what year? What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta? What does section 17 of the constitution say? Can you use canon power shot a 495 as webcam? How do I join delta sigma theta in Hampton? Imagine of oil supplies get exhausted have will affect your lifestyle? What is another word for most recent? What is Wales currency? What is 95 in hiragana? Does Ichiban Ushiro no Daimaou have nudity? What is the family for which AT89S52 belongs to? What did Georgia have more of than other states in World War 1? How can I safely and effectively remove popcorn ceilings through scraping?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.