answersLogoWhite

0

Does Miley Cyrus hate aisins

User Avatar

Anonymous

∙ 14y ago
Updated: 8/18/2019

no. it was a joke.

User Avatar

Wiki User

∙ 14y ago
Copy

What else can I help you with?

Related Questions

Does Ariana hate Miley Cyrus?

No, Ariana doesn't hate Miley Cyrus.


Does Miley Cyrus hate cheese?

No,Miley Cyrus does not hate cheese she actually loves it!


Is Demi Lovato and Miley Cyrus hate?

No, Demi Lovato doesn't claim to hate Miley Cyrus, and Miley Cyrus doesn't claim to hate Demi Lovato.


Does Miley Cyrus hate Bangladesh?

no Miley Cyrus does not hate bangaldesh infact she likes every country


Do dmei lavato hate Miley Cyrus?

Correction: " Does Demi Lovato hate Miley Cyrus? " Well: No of course not :)


Is Taylor swift friends with Miley Cyrus?

No, because i hate Miley Cyrus.


Why does Trace Cyrus hate Miley?

Ah? Trace doesnt hate miley -_-


Are there fans that hate Miley Cyrus?

Yes there are many people who hate Miley Cyrus, they even created a Miley Cyrus haters club. However, there are certainly others who do not dislike her as well.


Does Zac Efron hate Miley Cyrus?

Yes, zac hates miley cyrus!!!!!!!!!!!!!!!


Who does Miley Cyrus hate?

Miley Cyrus has not publicly announced hatred of any individual.


Does Miley Cyrus hate egyptians?

No


Does Miley Cyrus hate singing?

no she does not

Trending Questions
Should I have my car wrapped? Why does light have a dual wave particle model? What does the carrying of seeds to a new place? What was F. Scott Fitzgerald's daughter's name? What is the lecithin daily intake? What did suyuan woo tell an-mei when an-mei prepared for her trip to china? What cranial nerve is used for pupillary constriction? Can you use August in a sentence please? How many electrons in one columb? What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg? What is the significance of the spiritual rosary in the practice of prayer and meditation? How many votes does each state have in the electorial college? What is the closest airport to Osage Beach MO? How do you remove center console from 2004 Hyundai xg350? Is the Grand National cruel? What are symptoms of chiari malformation? What is the most poinsonous land snake? How do you integrate e powerintegral2x-1? Deciduous trees are those that? What is the US Mining Law of 1812?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.