0
What else can I help you with?
Related Questions
Do American crocodiles have live birth or lay eggs?
They lay eggs and heat it with covered grass
How do eggs get from a cow to your refrigerator?
Cows do not lay eggs,Cows do not lay eggs,
Do reptile lay eggs or have live young?
They lay eggs
Do caterpillars lay blue eggs?
caterpilles do not lay eggs. no thay lay white eggs
Do ball pythons lay eggs or have live birth?
They lay eggs.
Can amphibians have birth?
Almost all species of amphibians lay eggs.
Why do insects lay eggs in a pond?
why do inseets lay their eggs in a
Does the grasshopper lay its eggs in the water?
Grasshoppers do not lay eggs in the water. Instead, grasshoppers will lay eggs in the soil and wait for them to hatch.
Which birds does not lay egg?
Male birds do not lay eggs. Only female birds have the ability to lay eggs.
Robins lay eggs Cardinals lay eggs Sparrows lay eggs All birds must lay eggs The argument above is an example of?
inductive reasoning
Do birds have babies or do they lay eggs?
They lay eggs
Do jellyfish lay eggs or?
Yes, they lay eggs.
Trending Questions
What is Harry Styles from one direction favorite football team?
Is Utah Nevada Idaho and Western Colorado are all part of the Western Frontier?
What is the ratio for a visage from King Black Dragon?
How old where people when they joined world war 2?
How much should a 4'6 8 year old boy weigh?
What does the word mean having to do with community worship?
What are the complementary bases for the following DNA strand aatggccttagcagttgcatga?
What are codes called when procedures are grouped together?
When was Charles S. Kaelin born?
What is the law in Texas about children riding in the front seat of a vehicle?
What happened to miners and towns when the gold ran out?
Do organelles use energy from sunlight to produce food are called mitochondria?
What are five methods of nomination used today include?
How much work will be needed to lift a block weighin 4 newtons and a distance of 10 meters?
How old do you have to be to get a tattoo in Missouri if you already have one?
Have Holly Willoughby and Stephen Mulhern ever dated?
What tectonic plates does the eyjafjallajokull sit on?
How much transmission fluid do you need to change in a 1991 Toyota Land Cruiser?
What historical events happened in 1933?
What are the 5 odd numbers whose sum is 50 from 1 to 49?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.