answersLogoWhite

0

Does hale like guu

User Avatar

Anonymous

∙ 16y ago
Updated: 8/17/2019

when guu first came to hale's house he though she was cute, but the next morning she was a different guu. so i guess their just friends, but i think they like each other at times.

User Avatar

Wiki User

∙ 16y ago
Copy

What else can I help you with?

Related Questions

Where is it believed the sounds of the Brahmin ceremonies originate?

guu guu E.T


What are AGG and GUU examples of?

Valine


What was Nathan hale's Childhood like?

what was nathan hale's childhood like


Did Daniel Hale Williams like music?

Daniel Hale Williams did like music very much.


What are the codons and anticodons for the sequence auguucguuaacgaccaaauuuaa?

It would be UAC. RNA does not use thymine. It replaces it with Uracil. So instead of TAC it will be UAC.


What are the ratings and certificates for Janguru wa itsumo hare nochi Guu - 2001?

Janguru wa itsumo hare nochi Guu - 2001 is rated/received certificates of: South Korea:15 USA:TV-PG


What is the opposite gender of the earl?

Dutchess would be the opposite of Earl.


What is the Hebrew meaning for mic hale?

"mic hale" has no meaning in Hebrew. This sounds like a person's name.


What was Nathan's childhood like?

what was nathan hale's childhood like


Who will be playing Rosalie hale in new moon?

Rosalie Hale will be played, just like in Twilight, by Nikki Reed.


What Northern European city is a major European economic center?

dublin


What is a possible mRNA sequence of the amino acid valine?

GUU, GUC, GUA, GUG

Trending Questions
Where did baghad come from? In RNA, the base T is replaced with which nucleotide? What is the phone number for District 65 pension plan bank of America rocky hill NJ? Ken Lay was the chair of the board and the CEO? What are some adjectives that describe Ramses ii? How do you defeat the octopus in civilization wars? Why is silocon dioxide a compound? What is a biblio graphy for this cite? Can high blood pressure be a symptom of Chronic renal failure? How is a conclusion different from a theory? Why does my Sewing machine called Finesse 833 guaranteed by Pfaffhave a manual for it that is EXACTLY like Singer 833. What is with this Confusing. Are they the same machine? Are Okapis mammal? Where does the last name carrizales come from? What happens if the class action participant dies before receiving their settlement? Select all the depositional feautures listed below a valley b aquifer c delta d river? How much medical nitrous oxide does an h cylinder hold? What is the capital of the Aland Islands? What is moncytes? Is Guanajuato a country? Can a bisexual guy go with a bisexual girl?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.