Does hale like guu

Anonymous

∙ 16y ago

Updated: 8/17/2019

when guu first came to hale's house he though she was cute, but the next morning she was a different guu. so i guess their just friends, but i think they like each other at times.

Wiki User

∙ 16y ago

What else can I help you with?

Where is it believed the sounds of the Brahmin ceremonies originate?

guu guu E.T

What are AGG and GUU examples of?

Valine

What was Nathan hale's Childhood like?

what was nathan hale's childhood like

Did Daniel Hale Williams like music?

Daniel Hale Williams did like music very much.

What are the codons and anticodons for the sequence auguucguuaacgaccaaauuuaa?

It would be UAC. RNA does not use thymine. It replaces it with Uracil. So instead of TAC it will be UAC.

What are the ratings and certificates for Janguru wa itsumo hare nochi Guu - 2001?

Janguru wa itsumo hare nochi Guu - 2001 is rated/received certificates of: South Korea:15 USA:TV-PG

What is the opposite gender of the earl?

Dutchess would be the opposite of Earl.

What is the Hebrew meaning for mic hale?

"mic hale" has no meaning in Hebrew. This sounds like a person's name.

What was Nathan's childhood like?

what was nathan hale's childhood like

Who will be playing Rosalie hale in new moon?

Rosalie Hale will be played, just like in Twilight, by Nikki Reed.

What Northern European city is a major European economic center?

dublin

What is a possible mRNA sequence of the amino acid valine?

GUU, GUC, GUA, GUG

Trending Questions

How does distance an mass relate to the universal law of gravitation? Can I take Mucinex DM and DayQuil? What is enteric isolation? What came first after the Big Bang electrons or protons? What is a composite volcanoes magma made of? Where is the fuse for airmatic suspension Mercedes Benz E500? How do democracy peoples get freedom? Does Jimmy Bennett have a crush? Who is ti gf? Most none wonted job But is high paying? How many kilograms are in 204 pounds? What is the value of Colt Lighting? Where are the timing marks for a 2004 GM Aveo? Arsenal Football Club used to be known as Woolwich Arsenal? What were the expriements that addison bain do? When Alice's life threatened by Magua what did Duncan do? Can you freeze watermelon rind to use as a bowl to keep your fruit cool on a hot day? Can a landlord tell another landlord why you were evicted? Need a federal tax number for your deceased mother? What is another name for solar plexus?