Does hale like guu

Anonymous

∙ 16y ago

Updated: 8/17/2019

when guu first came to hale's house he though she was cute, but the next morning she was a different guu. so i guess their just friends, but i think they like each other at times.

Wiki User

∙ 16y ago

What else can I help you with?

Where is it believed the sounds of the Brahmin ceremonies originate?

guu guu E.T

What are AGG and GUU examples of?

Valine

What was Nathan hale's Childhood like?

what was nathan hale's childhood like

Did Daniel Hale Williams like music?

Daniel Hale Williams did like music very much.

What are the codons and anticodons for the sequence auguucguuaacgaccaaauuuaa?

It would be UAC. RNA does not use thymine. It replaces it with Uracil. So instead of TAC it will be UAC.

What are the ratings and certificates for Janguru wa itsumo hare nochi Guu - 2001?

Janguru wa itsumo hare nochi Guu - 2001 is rated/received certificates of: South Korea:15 USA:TV-PG

What is the opposite gender of the earl?

Dutchess would be the opposite of Earl.

What is the Hebrew meaning for mic hale?

"mic hale" has no meaning in Hebrew. This sounds like a person's name.

What was Nathan's childhood like?

what was nathan hale's childhood like

Who will be playing Rosalie hale in new moon?

Rosalie Hale will be played, just like in Twilight, by Nikki Reed.

What Northern European city is a major European economic center?

dublin

What is a possible mRNA sequence of the amino acid valine?

GUU, GUC, GUA, GUG

Trending Questions

When pregnant how do you know the baby is growing? What is gravitatonal energy? What is a difference between US government and Athens government? How do you use the word martyr in a sentence? What is the rate of 46 dollars for 5 toys? Does Rachel Mason have a baby on Waterloo Road? What is the value of the incredible hulk 180? How much is 145 kg in stone? Do salmon live in Lake Michigan? What is the working out for three fifths of forty pounds? How many caps did Tony Jordan get for England? How can you use tricks to make your ears pop? What is a pelacas? What are some good detective club names? Where are Tb patients are kept in? How many Saturdays are in the calendar year 2012? How many children did gunnar kaasen have? Can you cook cookies on aluminum foil? How do you install front breakes on a 2001 Chevy Tracker? What is the unit to express green energy?

Resources

Top Categories

Product

Company

Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.