answersLogoWhite

0

Does hale like guu

User Avatar

Anonymous

∙ 16y ago
Updated: 8/17/2019

when guu first came to hale's house he though she was cute, but the next morning she was a different guu. so i guess their just friends, but i think they like each other at times.

User Avatar

Wiki User

∙ 16y ago
Copy

What else can I help you with?

Related Questions

Where is it believed the sounds of the Brahmin ceremonies originate?

guu guu E.T


What are AGG and GUU examples of?

Valine


What was Nathan hale's Childhood like?

what was nathan hale's childhood like


Did Daniel Hale Williams like music?

Daniel Hale Williams did like music very much.


What are the codons and anticodons for the sequence auguucguuaacgaccaaauuuaa?

It would be UAC. RNA does not use thymine. It replaces it with Uracil. So instead of TAC it will be UAC.


What are the ratings and certificates for Janguru wa itsumo hare nochi Guu - 2001?

Janguru wa itsumo hare nochi Guu - 2001 is rated/received certificates of: South Korea:15 USA:TV-PG


What is the opposite gender of the earl?

Dutchess would be the opposite of Earl.


What is the Hebrew meaning for mic hale?

"mic hale" has no meaning in Hebrew. This sounds like a person's name.


What was Nathan's childhood like?

what was nathan hale's childhood like


Who will be playing Rosalie hale in new moon?

Rosalie Hale will be played, just like in Twilight, by Nikki Reed.


What Northern European city is a major European economic center?

dublin


What is a possible mRNA sequence of the amino acid valine?

GUU, GUC, GUA, GUG

Trending Questions
How many chapters are in Vampire Diaries nightfall? What is an engine break and how does it work in a vehicle? What is the name of the big sea? For what reason might an airport be particularly crowded? When is an object in equilibrium? What 9 odd numbers add up to 50? What is the biggest wetland in the world? What are the NCVPS psychology answers? What is the name of the bow tie type thing ray Charles used to wear? Where did the 54th Massachusetts volunteer infantry regiment fight in Massachusetts? Were is Aspiration Lake in Pokemon pearl? When was James Redfoord Bulwer born? Why did anne write about her pen in her diary? Scientist find dense rock on earths surface the is made of magnesium and smaller amounts of alum um and silicon What layer of earth might this rock help scientist study? Is there a risk of hot/ground reverse in the electrical wiring of this building? How do you change linear scale to direct statement? What type of electromagnetic wave is used for an MRI? What word means 'being many-footed? Does France has lager GDP than UK? What is the cheat code of nokia bounce game?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.