Does hale like guu

Anonymous

∙ 16y ago

Updated: 8/17/2019

when guu first came to hale's house he though she was cute, but the next morning she was a different guu. so i guess their just friends, but i think they like each other at times.

Wiki User

∙ 16y ago

What else can I help you with?

Where is it believed the sounds of the Brahmin ceremonies originate?

guu guu E.T

What are AGG and GUU examples of?

Valine

What was Nathan hale's Childhood like?

what was nathan hale's childhood like

Did Daniel Hale Williams like music?

Daniel Hale Williams did like music very much.

What are the codons and anticodons for the sequence auguucguuaacgaccaaauuuaa?

It would be UAC. RNA does not use thymine. It replaces it with Uracil. So instead of TAC it will be UAC.

What are the ratings and certificates for Janguru wa itsumo hare nochi Guu - 2001?

Janguru wa itsumo hare nochi Guu - 2001 is rated/received certificates of: South Korea:15 USA:TV-PG

What is the opposite gender of the earl?

Dutchess would be the opposite of Earl.

What is the Hebrew meaning for mic hale?

"mic hale" has no meaning in Hebrew. This sounds like a person's name.

What was Nathan's childhood like?

what was nathan hale's childhood like

Who will be playing Rosalie hale in new moon?

Rosalie Hale will be played, just like in Twilight, by Nikki Reed.

What Northern European city is a major European economic center?

dublin

What is a possible mRNA sequence of the amino acid valine?

GUU, GUC, GUA, GUG

Trending Questions

What is an antonym for renown? Which or the following is not a way that scientists generate hypothesis? What is mastrobetion? What did Abraham Lincoln write that became very famous? Is pacific ocean bigger than Indian ocean? How did Carl sanders appeal to urban voters? What is the phone number of the Wonder Wagon in Sacramento? What does zp mean in silver ring? What female singer sings people helping people for the liberty mutual commercial? How old is spiderman? What was life like for a teenager in the 1930s? Concept of financial analysis? What is Carmina Burana? Who are the members of the David Crowder Band? Where is the Baltic Branch-Siouxland in Baltic located? What would our life and world be like without communication? How do you replace thermostat on 2003 Lincoln aviator? How does Dragons Breath Shotgun ammunition work? Can a rectangle have consecutive sides that are congruent? 1002.0345 the place value of bold digit?