Does hale like guu

Anonymous

∙ 17y ago

Updated: 8/17/2019

when guu first came to hale's house he though she was cute, but the next morning she was a different guu. so i guess their just friends, but i think they like each other at times.

Wiki User

∙ 17y ago

What else can I help you with?

Where is it believed the sounds of the Brahmin ceremonies originate?

guu guu E.T

What are AGG and GUU examples of?

Valine

What was Nathan hale's Childhood like?

what was nathan hale's childhood like

Did Daniel Hale Williams like music?

Daniel Hale Williams did like music very much.

What are the codons and anticodons for the sequence auguucguuaacgaccaaauuuaa?

It would be UAC. RNA does not use thymine. It replaces it with Uracil. So instead of TAC it will be UAC.

What are the ratings and certificates for Janguru wa itsumo hare nochi Guu - 2001?

Janguru wa itsumo hare nochi Guu - 2001 is rated/received certificates of: South Korea:15 USA:TV-PG

What is the opposite gender of the earl?

Dutchess would be the opposite of Earl.

What is the Hebrew meaning for mic hale?

"mic hale" has no meaning in Hebrew. This sounds like a person's name.

What was Nathan's childhood like?

what was nathan hale's childhood like

Who will be playing Rosalie hale in new moon?

Rosalie Hale will be played, just like in Twilight, by Nikki Reed.

What Northern European city is a major European economic center?

dublin

What is a possible mRNA sequence of the amino acid valine?

GUU, GUC, GUA, GUG

Trending Questions

Will methadone test positive for morphine? What is the answer to the daily Jumble for March 10 2013? How did rebellions against the Roman Catholic Church affect Northern European society? How do the seat numbers for Ohio stadium run? Can you make a sentence using the word propensity? President Kennedy approved a plan to overthrow using Cuban exiles? What companies manufacture nitric acid? What kinds of irony are in 'The Gift of the Magi'? How old is Lolo Rodriguez? Is measurement the same thing as meter? What kingdom are phototrophic organisms found? Marine corp definition of lock and load? What is Channing tatum's favorite football team? Who brought down the Ming empire? What is one fifth of 235? Can you be pregnant if you had a two day long period? How do you unban yourself from smallworlds? How does a cardinal meet it's basic needs for living? You have oil in the driver side spark plug cylinder of your 02 neon anyone know why? Where is the IAT sensor located on your 1992 Acura Vigor with a 2.5L 5 Cylinder?

Resources

Top Categories

Product

Company

Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.