Does hale like guu

Anonymous

∙ 16y ago

Updated: 8/17/2019

when guu first came to hale's house he though she was cute, but the next morning she was a different guu. so i guess their just friends, but i think they like each other at times.

Wiki User

∙ 16y ago

What else can I help you with?

Where is it believed the sounds of the Brahmin ceremonies originate?

guu guu E.T

What are AGG and GUU examples of?

Valine

What was Nathan hale's Childhood like?

what was nathan hale's childhood like

Did Daniel Hale Williams like music?

Daniel Hale Williams did like music very much.

What are the codons and anticodons for the sequence auguucguuaacgaccaaauuuaa?

It would be UAC. RNA does not use thymine. It replaces it with Uracil. So instead of TAC it will be UAC.

What are the ratings and certificates for Janguru wa itsumo hare nochi Guu - 2001?

Janguru wa itsumo hare nochi Guu - 2001 is rated/received certificates of: South Korea:15 USA:TV-PG

What is the opposite gender of the earl?

Dutchess would be the opposite of Earl.

What is the Hebrew meaning for mic hale?

"mic hale" has no meaning in Hebrew. This sounds like a person's name.

What was Nathan's childhood like?

what was nathan hale's childhood like

Who will be playing Rosalie hale in new moon?

Rosalie Hale will be played, just like in Twilight, by Nikki Reed.

What Northern European city is a major European economic center?

dublin

What is a possible mRNA sequence of the amino acid valine?

GUU, GUC, GUA, GUG

Trending Questions

What can stop alpha particles? Is lacrosse fun? What is the name of the British currency? What is the cost of 4 inch PVC pipe? What is the average size of an ant? The pressure that builds in a plant cell as a result of osmosis is called? What is equivalent to 1 million characters of data? Can you watch Netflix on Motorola atrix? How much does halo reach cost in US? Why was the test tube held in the flame at 45 degrees angle? You want to spend as much time as you can touring the states? How can any difference of two numbers be restated as an equivalent addition statement? Who made the first Rock'n'Roll music video and what year was it made? How many calories in Moretti imported beer? Homonym for foretells future and gain? How many Academy Awards was the movie Young Frankenstein nominated for? What are 12 quotes by Alfred duckett? What is 31 degrees south 64 degrees west? Do Cornflowers have a smell? What is the value of a 1857 nickel?