Does hale like guu

Anonymous

∙ 16y ago

Updated: 8/17/2019

when guu first came to hale's house he though she was cute, but the next morning she was a different guu. so i guess their just friends, but i think they like each other at times.

Wiki User

∙ 16y ago

What else can I help you with?

Where is it believed the sounds of the Brahmin ceremonies originate?

guu guu E.T

What are AGG and GUU examples of?

Valine

What was Nathan hale's Childhood like?

what was nathan hale's childhood like

Did Daniel Hale Williams like music?

Daniel Hale Williams did like music very much.

What are the codons and anticodons for the sequence auguucguuaacgaccaaauuuaa?

It would be UAC. RNA does not use thymine. It replaces it with Uracil. So instead of TAC it will be UAC.

What are the ratings and certificates for Janguru wa itsumo hare nochi Guu - 2001?

Janguru wa itsumo hare nochi Guu - 2001 is rated/received certificates of: South Korea:15 USA:TV-PG

What is the Hebrew meaning for mic hale?

"mic hale" has no meaning in Hebrew. This sounds like a person's name.

What is the opposite gender of the earl?

Dutchess would be the opposite of Earl.

What was Nathan's childhood like?

what was nathan hale's childhood like

Who will be playing Rosalie hale in new moon?

Rosalie Hale will be played, just like in Twilight, by Nikki Reed.

What Northern European city is a major European economic center?

dublin

What is a possible mRNA sequence of the amino acid valine?

GUU, GUC, GUA, GUG

Trending Questions

Why is dihydrogen monoxide considered dangerous? How do you response when someone says 'Sup dawg'? What is the unix command to tail a file that is being written to? What skills are required to become a call center consultant? What is a boundary of a running track called? What types of genres are there? How did nabataeans build petra? What mountain range runs through the Scandinavian Peninsula? Why is a balanced triangle a good symbol of someone's total Heath? Whom did jesus learn to pray? How does sunlight help a person improve his health? What is the legal length of shotgun in Texas? Where can you find new Jughead and Betty fanfiction? Why do hermit crabs come out of their shells? Can you sue banks? What is the best electric type move? What is divisible in both 42 and 72? Translate 'i love you more then my life' in Punjabi? Why did olympic park in irvington burn down? How would you describe an object that you can see through?