answersLogoWhite

0

Does hawk claws powerful

User Avatar

Anonymous

∙ 14y ago
Updated: 8/19/2019

very! be careful!

User Avatar

Wiki User

∙ 14y ago
Copy

What else can I help you with?

Related Questions

Does a hawk got a claws?

Yes, hawks have claws. :P


How do powerful claws help an aardvark?

The aardvark use their powerful claws to break into ants or termites nests.


How do strong claws help a hawk meet its need for food?

It helps by the hawk hooking on the food then u eat it


What is a claw of an eggale or hawk called?

Those birds claws are 'talons'


Australian marsupial with powerful claws and continually growing teeth?

The wombat is an Australian marsupial with continually growing teeth, and powerful claws.


Which adaptation would help a hawk catch a mouse?

Talons/Claws would help a hawk catch a mouse.


Lives in water has poweRful claws?

a turtle


How powerful is a hawk?

Yes is the second powerful bird.(Eagle is the first)


What are a jaguar's strengths and weaknesses?

i know the strength their strength is that they are very powerful and they have powerful claws too


Summary of hawk roosting?

it personifies a hawk as a man being all powerful and assertive, and therefore allows us readers to relate with the hawk


What bird is the symbol of war?

Hawk because it is powerful


Is it true that polar bears will use their jaw or claws to attack?

Using their amazing strength to pin the prey, they hold it with their claws, and dispatch it with their powerful teeth and claws.

Trending Questions
What is wrong with my 2002 acura tl it sputters when I start it and stalls and then starts? What bodies of water border Europe? What is the definition of undegone? What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg? What is the Wrigley's United Profit - Sharing Coupon Five 573243 DRV worth? Was Odysseus friends with Achilles? What collage did Jane Goodall go to? Can you use one length of 3-wire cable to provide electricity to 2 separate circuits? Are bowling pins sad when they get knocked down? What would happen if animal testing wasnt present in a product? When are cn blue members birthday? How to arrange emails in chronological order? What year was gasoline 22 cents gallon? How many feet in eighteenth of a mile? Is tropical soil infertile? Vegetables are easily perishable because of their high content of? How far does the moon travel in 24 hours? Where is Newcastle in Dublin in Ireland? How can you make one cut in the hexagon to make a triangle and a pentagon? How many kilos is 32 Libras?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.