answersLogoWhite

0

Has Carl Sagan ever farted

User Avatar

Anonymous

∙ 13y ago
Updated: 8/20/2019

yes buttcheek

User Avatar

Wiki User

∙ 13y ago
Copy

What else can I help you with?

Related Questions

What is the birth name of Carl Sagan?

Carl Sagan's birth name is Sagan, Carl Edward.


How tall is Carl Sagan?

Carl Sagan is 5' 11".


Is carl sagan his real name?

Carl Sagan's name at birth was "Carl Edward Sagan"


Is Carl Sagan dead?

Carl Sagan died on December 20, 1996.


What is Carl Sagan's birthday?

Carl Sagan was born on November 9, 1934.


What was the name of Carl Sagan's sister?

Carl Sagan had a sister named Cari (Greene). Cari donated bone marrow to Carl for his bone marrow transplants near the end of his life.


What high school did Carl Sagan go to?

Carl Sagan went to high school at panoplies lingered


Are there any places named after Carl Sagan?

Yes, there is an asteroid named after Carl Sagan called 2709 Sagan. Additionally, the Carl Sagan Institute is an interdisciplinary research group at Cornell University dedicated to the study of life in the universe.


When did Carl Sagan die?

Carl Sagan died on December 20, 1996. He was 62 years old.


How tall was Carl Sagan?

Carl Sagan was 5 feet 10 inches tall (178 cm).


Where was Carl Sagan born?

Carl Sagan was born in Brooklyn, New York on November 9, 1934.


Which year did Carl Sagan go to the moon?

That has an easy answer: Carl Sagan was a scientist, not an astronaut. He did not go to the moon.

Trending Questions
What is the fractional notation for 8 over 7? What kind of animal is the ten-tailed demon beast? Would Typical form letters contain text and merge fields? Full form of hotel? Do you have garden at home? How do you tell if Chevy 350 is 5.0 or 5.7? Do all Jack Russells have webbed feet? Is the yeti friendly? What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA? What is the density of a moon rock that has a volume of 150 cubic centimeters and a mass of 350 grams? What reform was Justinian best remembered? Does any member of Cary Grant's family still live in Bristol? Does alcohol inhibit muscle growth? Why is delta seat selection unavailable? Where is the PCV valve location on a 2002 Infiniti you-35? 8 coins that equal a dollar? What has the author D Ehsan written? Tar effects on the body? Would you class Harry Potter books as monster stories? What 1995 Dustin Hoffman film was based on books hot zone and coming plague?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.