answersLogoWhite

0

How big is mizoram?

User Avatar

Anonymous

∙ 13y ago
Updated: 8/20/2019

Mizoram is a little over eight thousand square miles. It's population is around one million.

User Avatar

Wiki User

∙ 13y ago
Copy

What else can I help you with?

Related Questions

What is the area of Mizoram?

The area of Mizoram is 21,081 square kilometers.


When was Mizoram created?

Mizoram was created on 1987-02-20.


When was DD Mizoram created?

DD Mizoram was created in 1992.


When was Mizoram University created?

Mizoram University was created in 2001.


What is the capital of Mizoram state in India?

Aizawl is the capital of India's state of Mizoram.


When was Baptist Church of Mizoram created?

Baptist Church of Mizoram was created in 1894.


When was Mizoram Presbyterian Church created?

Mizoram Presbyterian Church was created in 1897.


When was Mizoram People's Conference created?

Mizoram People's Conference was created in 1975.


What is the motto of Mizoram University?

Mizoram University's motto is 'Greater deeds remain'.


How many distic mizoram?

Mizoram has 8 districts, 22 towns and 817 villages.


What is the Provincial flower of Mizoram?

The Red Vanda is the provincial flower of Mizoram, Republic of India.


What is the Provincial tree of Mizoram?

The Ironwood (Mesua ferrea) is the provincial tree of Mizoram, Republic of India.

Trending Questions
What are the organs located in hypogastric region? Which A-level subjects do I need to take if I am are persuing a degree in mass communication? What country invaded Korea in 1592? What is 21 degrees and 21 mins north and 157 degrees and 57 mins west? A White Computer Desk Can Be Calming? What gang has a burgundy flag? How do you say thank you so much in chuukese? How do you round 58.635 to the nearest hundredth? Can lifting weights cause constipation? What are the differences between responses of mammals and flowering plants? What is the area of the excel window in which you enter and edit data? Did descartes believe in the very powerful evil demon? Where do you get a diamond armlet? How far is it from Greenville SC to Cocoa Beach FL? What is an graphical operating system? What is a fem agress? Can a self cleaning oven be stopped before it's done? What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA? What did Joe Frazier do? What rhymes with calories?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.