0
What else can I help you with?
Related Questions
How many atomic bombs were built by the US for WWll?
4 were built during WW2trinitylittle boyfat manunnamed, unused
Who is Japan's most famous monster?
Godzilla is Japan's most famous monster. He was made to represent the U.S. bombs dropped on Nagasaki and Hiroshima during WWll after they dropped bombs and fighter planes at Pearl Harbor.
What allied countries fought in WWll?
what allied countries fougth in wwll
Why did the US enter WWll in Europe?
The Us entered WWll because Japan bombed Perl Harbor.
What are PBYs?
they are planes that were in wwll
What was the last battle of wwll?
Okinawa
Who were the allies of wwll?
Japan and Hungry.
What year did the wwll end?
1945
Why was propaganda created in wwll?
to get a life!
What year was wwll?
September 11, 2001
Wwll was fought on how many continents?
3
Who was the commander of the us during WWll?
FDR.
Trending Questions
What is the scientific notation of 7435?
Should you trust the answers on this side?
Are badgers decomposers?
When was Scooter Shooter created?
Who is Tice Davids?
What is the proper salutation to more than one doctor?
What is southern Portugal's weather like in January?
Where do celebrities hide?
Are plecostomus good algae eaters?
What did Petrarch believe?
Is Jeff Fatt a grandfather?
If you get married and then your sister gets married to your husband's brother is that legal?
Lyrics of bahay kubo with accent symbol?
Where is the timing chain located on a 1999 Plymouth breeze?
What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA?
Vitamina d de 5000 unt secundariosefectos?
90 Dodge colt where is the fuel pump located?
Can hypnosis be used to stop bleeding?
When did Lesley Wareing die?
What Bank Branch has the sort code 60-02-35?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.