0
What else can I help you with?
Related Questions
When was BlackBerry Storm created?
BlackBerry Storm was created in 2008.
When does the blackberry storm come out?
November 23rd 2008 in the United States. Blackberry made blackberry storm :)
Does the blackberry storm come with a stylus?
no. the blackberry storm is only compatible with your finger.
How much does the blackberry storm cost?
It isRumored $199 Price for BlackBerry Storm
Should you get the lg dare or wait for the blackberry storm?
Wait for the Blackberry Storm
Does the blackberry storm flip?
No, Blackberry Storm (Storm 1 or Storm 2) are not flip phones. For now, from the long linst of Blackberry phone models, there's only just the Blackberry Pearl 8220 that is a flip phone.
Witch phone is better the blackberry or the blackberry storm?
the blackberry storm apparently keeps freezing and stopping so I would recommend the blackberry
What is the latest Verizon blackberry?
The Blackberry Storm.
Is the blackberry storm the upgrade to a blackberry pearl?
no
Where can you find the serial number for the blackberry storm?
where is the serial number for the blackberry storm located?
Does the blackberry storm have blackberry mesanger?
Yes,All the blackberry's have messenger
Which Blackberry does Selena Gomez use?
blackberry storm
Trending Questions
What is wrong with my 2002 acura tl it sputters when I start it and stalls and then starts?
What bodies of water border Europe?
What is the definition of undegone?
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
What is the Wrigley's United Profit - Sharing Coupon Five 573243 DRV worth?
Was Odysseus friends with Achilles?
What collage did Jane Goodall go to?
Can you use one length of 3-wire cable to provide electricity to 2 separate circuits?
Are bowling pins sad when they get knocked down?
What would happen if animal testing wasnt present in a product?
When are cn blue members birthday?
How to arrange emails in chronological order?
What year was gasoline 22 cents gallon?
How many feet in eighteenth of a mile?
Is tropical soil infertile?
Vegetables are easily perishable because of their high content of?
How far does the moon travel in 24 hours?
Where is Newcastle in Dublin in Ireland?
How can you make one cut in the hexagon to make a triangle and a pentagon?
How many kilos is 32 Libras?
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.