answersLogoWhite

0

How do you get Harry Styles to like you?

User Avatar

Anonymous

∙ 13y ago
Updated: 8/20/2019

well basically you can always write him something. You can go to one of one direction's concerts and get the chance to meet him.

Hope i helped.

User Avatar

Wiki User

∙ 13y ago
Copy

What else can I help you with?

Related Questions

Does harry styles like the name harry?

harry did like the harry


Does Harry Styles like the Giants or Patriots?

Harry Styles likes the Giants.


What was Harry Styles birthname?

Harry Edward Milward is his real name. He uses styles like a stage name like lady gaga. what kind of parent would name there kid lady?


Who sings like you like?

harry styles


Does harry styles like swimming?

No.


Does harry styles like boy?

no


Does Harry Styles like to swim?

No.


What did Harry Styles mean by they like you because their fat?

Harry Styles things every girl is not fat!:)


What does Harry Styles do wen he is not singing?

When Harry styles is not singing he like to hang out with friends and sometimes rehearse


Does Harry Styles like Lady Gaga?

Harry Styles love Lady Gaga. He love her music


What does Harry Styles not like about himself?

Harry said he doesn't like his body


Does everyone hate Harry Styles?

No way! There are millions of Directioners out there, like for example me, and guess what: I LOVE HARRY STYLES.

Trending Questions
Is there a recall on 2006 PT cruiser? Where do you go to get a permit to put up a fence in LA? What is the mRNA strand for ggctatatcctgcgctatacgcta? In legend of Zelda spirit tracks I cannot reach the ice temple stamp station my boomerang does not reach the icy fire in that room how do I get the stamp? Which Ohio State Football player is called Animal? Worsted system and woolen system? What is another name for a tire's height? How many days old are you today if you were born March 8 1949? Is ohm's law applicable to ac or dc and why? Son and daughter of Ferdinand Magellan? How big is Selena gomez's mole? What is the value of a 2003 US dollar coin? Animals in trenches? Does Minnesota have tolls on its roads? What is 147 square feet converted to square meters? Is this statement true premiums for term life insurance decrease as people get older? What should I do if my toilet has a weak flush? When was Mann Kee Awaaz Pratigya created? What is the recipricol of 7654321? What is the unit price of a product?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.