answersLogoWhite

0

How do you get the army clothes in gta sa?

User Avatar

Anonymous

∙ 12y ago
Updated: 8/17/2019

buy clothes that are like it

User Avatar

Wiki User

∙ 12y ago
Copy

What else can I help you with?

Related Questions

How do you get military or army clothes on gta sa?

You can't get an army uniform but you could buy the "Black Undershirt", "Dogtags" and the "Green Camo Pants" to look like an Army Soldier.


Grand Theft Auto sa ps2 clothes mod?

Any kind of mod found on pc will only work on the pc version of gta sa. Sorry:(


How many clothes items to have in your wardrobe?

the clothes I have in my wardrobe in gta sa ps2 are valet unifom,croupier, gimp suit,pimp suit,spiderman,jeff hardy, and racing suit


What does SA mean in GTA SA?

San Andreas


Who survived GTA sa?

I DiD =)


How can you convert Grand Theft Auto iv cars to Grand Theft Auto sa cars?

You cannot, GTA SA has a much lower graphic system then GTA IV, plus the cars in GTA IV have more addons than GTA SA.


Can you date in GTAvcs?

No,you can only do so in gta IV or gta SA


Where can you get GTA sa free?

Here.


Is there a snow cheat on GTA SA?

No.


Are there hookers in GTAtbogt?

there are in GTA SA


Can you do a mission in gta sa after you have finished it?

no you can not


Is there cheat for robots in GTA SA?

no

Trending Questions
What size wire is needed for 15 amps over a distance of 300 feet? Are how to have a mermaid baby? How to reset jaguar fail safe? Does royal gelatin jello have pig fat? What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg? Will headers get the starter hot so the car won't crank? How can I effectively glue rattan to wood? What does mean when he ask you ask? Where does Guano originate from? To Hrothgar was given such glory of war such honor of combat that all his kin obeyed him gladly till great grew his band of youthful comrades infers? Is there an Altaic language family? Why do ecologists ask questions about events and organisms that range in complexity from an individual to the biosphere? What kind of root and venation does bean have? If a box had to be 200 cubic inches what size would it have to be in standard inches? What is the least common multiplus of 21? Why is your 1982 Ford Bronco hard to start? How much is the frank thomas baseball card worth? Can you get introuble if someone is underage drinking at your house and you have a sign up? Is it possible for a guy who turned you down to still be jealous when he knows there is another guy in your life? What is that song on the movie igor talking about big girls?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.