answersLogoWhite

0

How do you get the oaks letter in pokemon daimond?

User Avatar

Anonymous

∙ 11y ago
Updated: 8/17/2019

You get it from Mystery Gift. You can use it to get Shaymin. If you do get Shaymin, go to Floroma Town and talk to one of the ladies there and she should give you a Gradedia flower to transform Shaymin into it's Sky Forme.

User Avatar

Wiki User

∙ 11y ago
Copy

What else can I help you with?

Related Questions

Does anyone have professor oaks letter in Pokemon?

no


How do you get into the extra area in backlot mansion on Pokemon platinum?

u need oaks letter that's where shaymin is get oaks letter.


What do you do with oaks letter on Pokemon Platinum?

take it to the rock up there by the Pokemon league


Where do you get Palkia in Pokemon Daimond?

you have to trade from pearl


How do you erase file on pokemon daimond?

it tells you how


How To Get Oaks Letter On Pokemon Diamond?

Via Nintendo Wifi.


Is oak's letter shareable in Pokemon Platinum?

No. The Shaymin event (oaks letter) in Pokemon platinum is not shareable. ~Bellafuzz


Where can you find a unknown on pokemon daimond?

solacoen ruins


Where do you find regiice on pokemon daimond?

in a Nintendo event


How do you get a Darkrai on pokemon daimond?

you have to get it at an event or get an action replay


What Pokemon events will there be in 2010?

members card, Oaks letter, Arceus,


Is oaks letter any use in Pokemon heartgold?

No because it does mater

Trending Questions
Is there a recall on 2006 PT cruiser? Where do you go to get a permit to put up a fence in LA? What is the mRNA strand for ggctatatcctgcgctatacgcta? In legend of Zelda spirit tracks I cannot reach the ice temple stamp station my boomerang does not reach the icy fire in that room how do I get the stamp? Which Ohio State Football player is called Animal? Worsted system and woolen system? What is another name for a tire's height? How many days old are you today if you were born March 8 1949? Is ohm's law applicable to ac or dc and why? Son and daughter of Ferdinand Magellan? How big is Selena gomez's mole? What is the value of a 2003 US dollar coin? Animals in trenches? Does Minnesota have tolls on its roads? What is 147 square feet converted to square meters? Is this statement true premiums for term life insurance decrease as people get older? What should I do if my toilet has a weak flush? When was Mann Kee Awaaz Pratigya created? What is the recipricol of 7654321? What is the unit price of a product?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.