0
What else can I help you with?
Related Questions
How do you meet real santa?
You go to the North Pole and search!
Is. Santa real yes or no?
Santa Claus is real - YES he is real.
Is Santa' reindeer real?
Yes, Santa's reindeers are real if you believe Santa is real! Many people believe Santa is real, but if Santa is real then his reindeers are real! What would the reindeers do if Santa wasn't real, there's no bother for them then!
Is a Santa Claus elf Real?
YES...santa`s elves are real because santa is real
Is there a Santa in Mexico for real?
Not a real Santa but people in Mexico believe in Santa.
Is blue Santa real?
no i don't think blue Santa is real but Santa is
Are the elves who help Santa real?
Of course the elves who help Santa Claus are real!!! the elf dolls are real but santa is not.
Who killed Santa for he is not real?
no body killed santa he is real
How do you say where are the real presents Santa?
where are the real presents santa
How do you meet Santa Claus?
You can go to the mall and meet him
Is the Santa in Lapland the real santa?
santa is also satan, and is real. he lives in the north atlantic.
What health issue was in the 1840's?
Is Santa Real?Santa is not real?
Trending Questions
Was Saint Patrick an Italian?
If your mother is mixed and your dad is black does that mean you are mixed?
Why is Charles Darwin on the back of a Bank of England Ten Pound note?
What strong and haunting realization scares Cole more than anything else?
What is the thickest layer?
Is the song Sometimes by Step by Rich Mullins public domain?
What is the expanded form of 22.361?
Will a 2 year old boy that got an electrical shock be okay?
Do coyotes live in the taiga forest?
What are the names of the current Pittsburgh Steelers?
When is the best time to fold in Texas Hold'em?
How might psychological factors affect the business cycle?
When was Simmer in Your Hotseat created?
Does a weed lollipop get you high?
Why do you keep letting Muslims into the UK?
How do you draw a 179 degrees angle?
Where is OBD connector for Subaru legacy 2004?
What is expected and unexpected news?
How can you get rid of black bruise on cheeks of the face from a blow?
What are the complementary bases for the following DNA strand aatggccttagcagttgcatga?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.