answersLogoWhite

0

How do you get to school in Chile?

User Avatar

Anonymous

∙ 13y ago
Updated: 8/20/2019

get a bowl and a spoon and eat it

User Avatar

Wiki User

∙ 13y ago
Copy

What else can I help you with?

Related Questions

How old do you have to be to be in school in Chile?

You have to be 4 years old to go to school in Chile. You can stop going when you are 13 years old.


How many children attend school in Chile?

thairs are 50,343 schools in chile.


When does school start in Chile?

March


Is school required in Chile?

Yes


Does kids in Chile go to school?

yes they do


Do children go to school in chile?

yes


Is Chile an Asian country?

No. Go to school.


What is school like in Chile?

Maybe nice.


Do kids in chile go to school?

i think so


How long is the school day in Chile?

For 12 years in grade school. starting usually at the age of 6 and ending at the age of 17 or 18. You also can attend preschool and start school as early as 3. After preschool you would be in kindergarden then start 1st grade.


What time do kids go to school in Chile?

about 8:30am till 4pm.


What country is bigger Chile or Peru?

wow go back to school girl the answer is al;skd fhaio;wr hgahr tvoqwe hehehe

Trending Questions
Tattoos that represent travel? Which of the events was most influential in bringing the US into the world war 2? What were the elements and functions of god myths? Give two types of evidence for continental drift with an example of each type? When you rate their depression on a scale from 1-10. their response are what in your study? What is the distance between the points (1 -2) and (-93) on a grid? Why were marriages arranged in Shakespeare's time? Why does carbon conduct electricity if it is a non metal? What should you do if the application of one Combat Application Trouniquet does not stop bleeding? What is minimum age of a imam? Would mung bean grow without water? How many amps does a one horse power motor draw? How long will it take to run 1.5 miles at 7 miles per hour? Is sign language a forgen language? What language do Wales people talk? What is a catchy title for a science fair project on heat? What words have the same vowel sound as the word ground? What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg? What is the common name for the spine? How many people use health app from their cell phone?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.