0
What else can I help you with?
Related Questions
How do you recover your WeeWorld email?
by asking weeworld
Who is CleoMeo the cweeture on weeworld?
its a cat on weeworld
Does Zayn Malik have a weeworld?
does Zayn have a weeworld
Does AOL have WeeWorld?
Aim(aol) has a weeworld app that connects you weeworld to your aim which also makes your weeworld avatar like the one you see on the website
How do you quit WeeWorld?
you just stop playing on weeworld
How do you unblock WeeWorld at school?
how do u unblock weeworld
How do you delete weeworld?
You can not delete your weeworld you just stop using it!
How do you email WeeWorld?
You can contact Weeworld by going to the Help Center.
What are some cheats on WeeWorld that you can use?
There are currently NO Weeworld cheats.
How do you delete a WeeWorld?
Go into feedback and tell weeworld, that they can delete your account( :
Is WeeWorld for kids?
yes weeworld is for all kids that want to play
Is WeeWorld real or fake?
weeworld is real you go to weeworld.com and it will appear
Trending Questions
Who is the Maytag man?
What does a skunk's home look like?
How long does it take to drive 8 miles at 25 mph?
What U.S. senator used Americans' fear of communism to promote his career by making baseless accusations of communist activities in the US?
Can 634 be divided by 4?
What is the best Pokemon from gen 6?
What is one third of 2000 dollar?
How do you change the idler pulley on a 1994 Ford Bronco?
How do you use ryphnol?
Can you glue the headliner on a 1995 Lincoln Town Car back on?
How did people fall victim to the black death?
Where do you pay Oklahoma Highway Patrol troop J traffic ticket?
How do ciliates multiply?
Who was Elijah clarke in Revolutionary War?
If a tape measure could be run along the equator how many miles would it stretch?
What is the best way to prepare a delicious dish using cross cut beef shank?
What were comparisons of Langston hughes and w e b dubois?
How do globalization affect the economies of neighboring countries of Mexico?
Who engraved browning 22 rifles with initials JL?
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.