0
What else can I help you with?
Related Questions
How do you make a desert in alchemy classic?
sand + sand
How do you make a desert on alchemy game on droid?
You have to buy the app for it.
How do you make desert on little alchemy?
put two sands together or sand+sand= desert
How do you make cactus on alchemy game on droid?
Tree+ desert = cactus
How do you make animals on alchemy?
you cant make animals on alchemy... actually you can, one animal is a bird.
How do you make glasshouse in alchemy?
There is no such thing as alchemy.
How do make sword in Little Alchemy?
how to make a sword in little alchemy
Fastest way to make an alchemy?
You don't make an alchemy, alchemy is when you cast a spell on something and it turns it into money.
How do you make trilobites on alchemy game?
how do you make trilobite on abc 3 alchemy
How do you make Pinocchio on alchemy?
how to make pinocchio in littie alchemy
How do you make combine on alchemy?
You combine a blade and metal to make a sword on alchemy. :)
How do you make life on zeds alchemy?
Zed's alchemy
Trending Questions
How do you spell tightening?
How does Medea help Jason accomplish his task?
What amenities does the business center at this hotel offer for guests?
Can you post toy cap guns on craigslist?
When was candle discovered?
Define debit note?
What is the slope of the line that passes through the points 2 16 and 5 4?
Letter to withdraw from business partnership?
How do you fit a door barrel to a Skoda octavia?
Does Fred live in Columbus Nebraska?
Is there a relay or fuse for a 94 es300 shift solenoid you are getting a shift solenoid E code reading and your overdrive is not working properly?
According to the encoding specificity principle the context in which people encode and later?
Why is that the elements in the fourth group in the periodic table have high boiling point?
4 square roots of 6 divided by four square roots of 8?
Can you file a lis pendis if your mortgage company is refusing to help you keep your home?
How many NBA players are under six feet tall?
What are the complementary bases for the following DNA strand aatggccttagcagttgcatga?
What is the fraction for 17.50?
Which of the following best describes Russia's motivation for freeing its serfs?
What are two postmodern literary techniques?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.