0
What else can I help you with?
Related Questions
What is the main ingredient needed to make borscht?
Beetroot.
A Russian or polish soup based on beetroot?
That is 'borscht' made from beetroots.
How do you make animals on alchemy?
you cant make animals on alchemy... actually you can, one animal is a bird.
Is this how you spell Borscht?
Yes, that is how you spell borscht. It is a Ukrainian soup.
How do you make glasshouse in alchemy?
There is no such thing as alchemy.
How do make sword in Little Alchemy?
how to make a sword in little alchemy
Fastest way to make an alchemy?
You don't make an alchemy, alchemy is when you cast a spell on something and it turns it into money.
How do you make trilobites on alchemy game?
how do you make trilobite on abc 3 alchemy
How do you make combine on alchemy?
You combine a blade and metal to make a sword on alchemy. :)
How do you make Pinocchio on alchemy?
how to make pinocchio in littie alchemy
How do you make life on zeds alchemy?
Zed's alchemy
How do you make Forest on little alchemy?
How do you make axe on little alchemy? blade+wood
Trending Questions
What is the difference between a white wizard and a grey wizard?
What is a cantus?
How long should there be light for a fresh water tank?
Who is jimmy studebaker?
On a balance sheet what does members' deficit mean?
What is a fabrica dearmas oviedo 1931 worth?
What does cephalic means in ultrasound?
Words that start with the letter g and end with the letter R?
What is the song from the Glee commercial lyrics are I'm ready now or something like that?
When was greek salad invented?
Why would you expect a dead zone to start near the mouth of a river where the river flows into a body of water?
What are euro notes made of?
What is the definition of the word geo?
What is the correct complementary DNA starnd for gacatcgttgactacggctgatc?
You just burned your finger on a pan that just came out of a 400 degree oven what should you do?
What was the name of Joey's soap opera?
What nationality is the surname Goike?
What is the connotation of the word prim?
Kasukdulan parte ng sa pula sa puti ni francisco rodrigo?
Who wrote the poem street music?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.