0
What else can I help you with?
Related Questions
How do you say french toast sticks in Spanish?
French toast sticks in Spanish is 'pan tostado francés.'
What is french toast in Spanish?
Tostada Francesa
How do you say French toast in French?
French toast is 'du pain perdu' in French.
What does tostadas Frances mean in Spanish?
"French toast"
Did the French invent French toast?
To be honest, no one really knows, some say it is from America, others say England and Spain. but ive been researching it and it seems that french toast it actually from Spain! French toast was named after Joesph French the inventer!
How you say toast cubes in french?
crouton
How do you say toast machine in french?
"grille pain" is french for toaster
How do you say french toast in Italian?
In Italy we don't eat french toasts, so we don't have a word for it. Some Italian recipebooks refer to it as "French Toast".
What word do you say in spanish when you're toast with your friends?
Salud.
How do you say torch in spanish?
el pan tostado is how you say toast.
What do spanish people say when they toast?
It is called a brindis. They say, "salud" which means health.
What do you say in French when you toast?
"Santé !", "Tchin" or "A la tienne"
Trending Questions
How can I fix a toilet leaking from the pipe at the back?
Why is Sudan a Islamic country?
What is a real estate cash flow note?
Applications of a circular waveguides?
What is the area if the circumference is 40.8cm?
What does qing wen ni ma jia you jia you ji kou ren mean in Chinese?
What occurs when a muscle becomes smaller and weaker from not being used?
How many soldiers were sent to World War 1?
Why would someone need their legs amputated?
Pressure in terms of mm of water?
Where does Luke go directly after leaving Tatooine Star Wars?
What is the potential of a reference node in DC circuits?
How do you figure the answer to what percent of 40 is 4?
What is yoon eun hye's height?
What was john waynes horse in chism?
What is a parabola the graph of?
What is the area of a circle with a radios of 4?
When did Joseph Maull die?
Which of the following shows topical organization?
What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.