0
What else can I help you with?
Related Questions
How do you say I love having you for a friend in Italian?
Amo averti come amico
Did pasta originate in Italy?
As an Italian I would not say it is sacred, however, we do love our pasta!As an Italian I would not say it is sacred, however, we do love our pasta!As an Italian I would not say it is sacred, however, we do love our pasta!As an Italian I would not say it is sacred, however, we do love our pasta!As an Italian I would not say it is sacred, however, we do love our pasta!As an Italian I would not say it is sacred, however, we do love our pasta!
How do you say FULL Love in Italian?
full love in Italian is "in pieno amore"
How do you say i love Milan ' in Italian?
i love milan
How do you say love you in Italian?
you say amo (a mo)
How you say love in italian?
Amore
What is 'How do you say' when translated from English to Italian?
"How do you say?" in English is Come si dice? in Italian.
How do you say come on England in Italian?
Come on england
How do you say in love in italian?
I think you would say amore /aˈmore/
How do you say 'how are things' in Italian?
Come va?
How do you say love you gorgeous in Italian?
Mi luv
How do you say i love Robert Italian?
Amo Robert
Trending Questions
How do you get relichant in Pokemon?
British most wanted?
How many grams is 4 cups of diced apples?
What are the differences between water erosion and water deposition?
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
How does the process of newborn skull development impact overall growth and development in infants?
What causes a transaxle on my 2005 Ford Freestar to get hot?
Who kills Alison in Pretty Little Liars?
Are there any data free usage apps on iPhone?
Different Types Of Arousal in sport?
Where do toadfish live?
How can you call the people on a congregation?
How long does it take for a tree to fully be grown?
When does Suburgatory season 2 come out on DVD?
What is the mission statement for abbott labs?
What was the delorian car made of?
How much does a steinway d cost?
How do you troubleshoot a moving fuel gauge on a 2000 Chevrolet impala 3.4L?
How do you tell how old a terrapin is?
What is 4198 to the nearest 100?
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.