answersLogoWhite

0

How do you say free chicken in spanish?

User Avatar

Anonymous

∙ 13y ago
Updated: 8/20/2019

It means "Pollo gratis"

User Avatar

Wiki User

∙ 13y ago
Copy

What else can I help you with?

Related Questions

How do you say free range in Spanish?

Free range = de granja Free-range chicken = pollo de granja


How do you say chicken in Spanish?

chicken means el pollo in spanish.


How do you say chicken in a diffeent language?

Pollo is Spanish for chicken.


How do you say hen in Spanish?

Gallina Chicken in Spanish is already female.


How do you say chicken thigh in Spanish?

You can say "muslo de pollo".


How do you say talkative chicken in Spanish?

pollo ablador


How do you say chicken box in spanish?

pollo caja


How do say Fried chicken in spanish?

pollo frito


How do you say i love you chicken in spanish?

Me fascina el pollo. In Spanish we don't say: "Te amo pollo".


Say rice with chicken in Spanish?

Arroz con Pollo


How do you say barbeque chicken in spanish?

barbacoa de pollo


How do you say chicken butt in Spanish?

tope del pollo

Trending Questions
Should I have my car wrapped? Why does light have a dual wave particle model? What does the carrying of seeds to a new place? What was F. Scott Fitzgerald's daughter's name? What is the lecithin daily intake? What did suyuan woo tell an-mei when an-mei prepared for her trip to china? What cranial nerve is used for pupillary constriction? Can you use August in a sentence please? How many electrons in one columb? What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg? What is the significance of the spiritual rosary in the practice of prayer and meditation? How many votes does each state have in the electorial college? What is the closest airport to Osage Beach MO? How do you remove center console from 2004 Hyundai xg350? Is the Grand National cruel? What are symptoms of chiari malformation? What is the most poinsonous land snake? How do you integrate e powerintegral2x-1? Deciduous trees are those that? What is the US Mining Law of 1812?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.