0
What else can I help you with?
Related Questions
How do you say where is the sun in French?
To ask "Where is the sun?" in French, you can say où est le soleil?
How do you say the sun is out in french?
To say "the sun is out" in French, you would say "le soleil est sorti".
How do you say near in french?
Near = pres (de)...
How do you say for the sun' in french?
for the sun = pour le soleil
How do you say is near in french?
'[C']est pres [de]' is '[It] is near [to]'.
How do you say near the in French?
pour sol
How do you say the sun and moon in French?
The sun in French is le soleil (masc.) and the moon is la lune (fem.).
How do you say sun dial in french?
"cadran solaire" is the french word of sundial.
How do you say i live near in french?
J'habite près de ...
How do you say great sun in french?
magandang hapon.
How do you say sun is shining in french?
ellia do sole mefuc
How do you say the sun is shining in french?
le soleil brille
Trending Questions
Did Jim harbaugh beat Ohio state in football as quarter back?
How do you start Homeschooling?
How much does it cost to change your existing fireplace into a gas one?
How many firearms can you carry if you have a concealed weapons permit?
How can an International Medical Graduate becomes a Physician Assistant?
How long did the Christmas truce in World War 1 last?
How do you say good food in Hawaii?
Alignment toe in specs F350 ford dually?
What happens if you alter a driver's license?
What are the complementary bases for the following DNA strand aatggccttagcagttgcatga?
Convert 3.4 to a fraction?
Can klippel -feil syndrome be prevented?
When was Basant Kumar Birla born?
What type of Canadian service do you think has the potential yo increase its export?
Can ricotta cheese be frozen for later use?
What was John the Baptist's hobbies?
From what two points does the Great Wall Of China span?
What do scientists use to describe the way energy flows through an ecosystem?
What do you get if you pack a punch an M16?
Will oil conduct electricity?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.