answersLogoWhite

0

How do you say sweet shop in welsh?

User Avatar

Anonymous

∙ 14y ago
Updated: 8/17/2019

siop losiyn (pronounced shop lossiun) siop dadas (pronunced shop dad AZ or siop swits (pronounced shop sweets)

User Avatar

Wiki User

∙ 14y ago
Copy

What else can I help you with?

Related Questions

How do you say sweet dreams in Welsh?

To say, "have sweet dreams" in Welsh is "cewch breuddwydion hyfryd"


How do you say sweet in Welsh?

Melys (flavour).


How do you say home sweet home in welsh?

Does Unman yn Debyg i Gartref


What is Welsh for sweet?

'Loshyn' is the welsh word for 'Sweet' or 'Dâ-Dâ' Sweet as in 'this cake is sweet' would be 'melys'


What does siop mean in welsh?

It means shop.


How do you say sweet shop in french?

magasin de bonbons


How do you say you are Welsh?

"You are Welsh" = Rwyt ti'n Gymreig


When was Sweet Shop created?

Sweet Shop was created in 1994.


How do you say 'our friends' in Welsh?

'Our Friends' in Welsh is 'Ffrindiau Ni' :)


How do you say your house in Welsh?

To say "your house" in Welsh, you would say "eich tŷ".


How do you say welsh in welsh?

Cymraeg


What is the Welsh for 'Sweet dreams'?

Cewch breuddwydion hyfryd

Trending Questions
How many miles between Scottsboro Alabama and Baton Rouge Louisiana? What is the mRNA strand for ggctatatcctgcgctatacgcta? What is a thin strand of hair called? How many extinct animals are there right now in the world? How do you download Vista drivers for a H P printer? How many countries were effected by world war 1? Why is it important to mind your own business? What does the father begets the son mean? What does PAP look like? Why is the chicken drumstick indigestible for old lady? What fraction correctly represents 0.63? What are the standard dimensions of a home door? What is the name of Paul McCartney's sheepdog? How many years in a sesquicentenary? What is a icd 9 code for ESR? How do you build gondola the base mysims kingdom? Why does buttermilk look kind of like yogurt? What type of polynomial is shown below 7x2-3x plus 4? Can you give an example of a response to a welcome speech for church? How many northern pikes are caught a year in Minnesota?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.